Incidental Mutation 'R3710:Rps3'
ID 259548
Institutional Source Beutler Lab
Gene Symbol Rps3
Ensembl Gene ENSMUSG00000030744
Gene Name ribosomal protein S3
Synonyms D7Ertd795e
MMRRC Submission 040703-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.963) question?
Stock # R3710 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 99127103-99132916 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99128626 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 197 (K197R)
Ref Sequence ENSEMBL: ENSMUSP00000032998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032998] [ENSMUST00000107096] [ENSMUST00000208532]
AlphaFold P62908
Predicted Effect probably benign
Transcript: ENSMUST00000032998
AA Change: K197R

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000032998
Gene: ENSMUSG00000030744
AA Change: K197R

DomainStartEndE-ValueType
KH 42 111 2.83e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083888
Predicted Effect probably benign
Transcript: ENSMUST00000107096
SMART Domains Protein: ENSMUSP00000102713
Gene: ENSMUSG00000030744

DomainStartEndE-ValueType
KH 42 111 2.83e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128725
Predicted Effect probably benign
Transcript: ENSMUST00000208532
Meta Mutation Damage Score 0.0638 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit, where it forms part of the domain where translation is initiated. The protein belongs to the S3P family of ribosomal proteins. Studies of the mouse and rat proteins have demonstrated that the protein has an extraribosomal role as an endonuclease involved in the repair of UV-induced DNA damage. The protein appears to be located in both the cytoplasm and nucleus but not in the nucleolus. Higher levels of expression of this gene in colon adenocarcinomas and adenomatous polyps compared to adjacent normal colonic mucosa have been observed. This gene is co-transcribed with the small nucleolar RNA genes U15A and U15B, which are located in its first and fifth introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,597,384 (GRCm39) probably benign Het
Agbl2 G A 2: 90,636,152 (GRCm39) D563N probably benign Het
Aida C A 1: 183,085,610 (GRCm39) probably null Het
Ank1 A G 8: 23,577,095 (GRCm39) D200G probably damaging Het
Ankrd28 A G 14: 31,470,808 (GRCm39) probably benign Het
Ap3b2 C T 7: 81,123,598 (GRCm39) probably benign Het
Atrnl1 C A 19: 57,645,546 (GRCm39) H469N probably damaging Het
B4galt3 C A 1: 171,101,613 (GRCm39) H196N probably damaging Het
Bud23 A C 5: 135,085,204 (GRCm39) S41A possibly damaging Het
Car12 G T 9: 66,658,260 (GRCm39) A21S probably damaging Het
Cav3 T A 6: 112,436,774 (GRCm39) M1K probably null Het
Cdc42bpa A G 1: 179,892,628 (GRCm39) D264G probably damaging Het
Cic A G 7: 24,986,406 (GRCm39) D1276G probably damaging Het
Col2a1 A G 15: 97,888,788 (GRCm39) probably benign Het
Col9a2 C G 4: 120,911,455 (GRCm39) R599G probably damaging Het
Csn3 C A 5: 88,077,882 (GRCm39) N129K possibly damaging Het
Diaph1 C A 18: 37,978,537 (GRCm39) G1209W probably damaging Het
Dsg2 A G 18: 20,735,174 (GRCm39) T1051A probably damaging Het
Gm1965 A T 6: 89,122,407 (GRCm39) noncoding transcript Het
Gprc6a CAAA CA 10: 51,491,776 (GRCm39) probably null Het
Gsto1 T C 19: 47,847,971 (GRCm39) probably null Het
Il15ra G T 2: 11,735,458 (GRCm39) probably null Het
Ipo8 A T 6: 148,707,842 (GRCm39) probably null Het
Lsm14a T A 7: 34,053,204 (GRCm39) I283F probably damaging Het
Mael T C 1: 166,066,135 (GRCm39) D34G probably damaging Het
Marchf6 A T 15: 31,509,972 (GRCm39) probably benign Het
Mtmr10 C A 7: 63,976,433 (GRCm39) A410D possibly damaging Het
Myh9 T C 15: 77,657,547 (GRCm39) E1066G possibly damaging Het
Nim1k A G 13: 120,173,635 (GRCm39) S420P probably benign Het
Nlrp4c T A 7: 6,068,627 (GRCm39) V176E probably damaging Het
Ogfod1 A T 8: 94,784,380 (GRCm39) K313* probably null Het
Or5an1 T G 19: 12,260,450 (GRCm39) F13V probably damaging Het
Osbpl10 C A 9: 115,036,655 (GRCm39) P253Q probably benign Het
Otof A T 5: 30,542,610 (GRCm39) M661K probably benign Het
Rbms2 C T 10: 127,979,312 (GRCm39) R139Q probably damaging Het
Rimbp2 G A 5: 128,866,795 (GRCm39) T508I probably benign Het
Ros1 A T 10: 52,037,991 (GRCm39) C393* probably null Het
Rps17 T A 7: 80,994,672 (GRCm39) T30S probably benign Het
Samd11 G A 4: 156,334,952 (GRCm39) L109F probably damaging Het
Smarca2 T G 19: 26,646,290 (GRCm39) probably benign Het
Sprr2g C A 3: 92,282,036 (GRCm39) P30Q unknown Het
Spz1 G A 13: 92,711,631 (GRCm39) Q282* probably null Het
Syne3 A G 12: 104,909,697 (GRCm39) L713P possibly damaging Het
Tgm1 C A 14: 55,950,052 (GRCm39) probably benign Het
Tomm22 T C 15: 79,555,419 (GRCm39) F55L probably damaging Het
Tph2 T A 10: 115,009,963 (GRCm39) Y199F probably benign Het
Vmn2r108 A T 17: 20,682,932 (GRCm39) F757L probably benign Het
Vmn2r69 T A 7: 85,055,601 (GRCm39) T846S probably benign Het
Was G T X: 7,952,927 (GRCm39) S271R probably benign Het
Zc3hav1 A C 6: 38,309,097 (GRCm39) M575R probably benign Het
Other mutations in Rps3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Rps3 APN 7 99,128,479 (GRCm39) critical splice donor site probably null
R3894:Rps3 UTSW 7 99,129,103 (GRCm39) missense probably benign 0.07
R3895:Rps3 UTSW 7 99,129,103 (GRCm39) missense probably benign 0.07
R4165:Rps3 UTSW 7 99,132,816 (GRCm39) missense probably benign 0.00
R8318:Rps3 UTSW 7 99,132,938 (GRCm39) unclassified probably benign
R8797:Rps3 UTSW 7 99,132,797 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCAGTAAAAGCAGTTTGACCTG -3'
(R):5'- CTGTACATGGTTCCCTTGGC -3'

Sequencing Primer
(F):5'- CTGGGAAGGTCACTGCAGACATAC -3'
(R):5'- CATGGTTCCCTTGGCAAAAG -3'
Posted On 2015-01-23