Incidental Mutation 'R4257:Gm9755'
ID321864
Institutional Source Beutler Lab
Gene Symbol Gm9755
Ensembl Gene ENSMUSG00000030735
Gene Namepredicted pseudogene 9755
Synonyms
MMRRC Submission 041070-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R4257 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location67514000-67515606 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to T at 67514477 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000032981
SMART Domains Protein: ENSMUSP00000091180
Gene: ENSMUSG00000030735

DomainStartEndE-ValueType
Pfam:GTP_EFTU 55 249 1.4e-55 PFAM
Pfam:GTP_EFTU_D2 272 341 4.8e-17 PFAM
Pfam:GTP_EFTU_D3 345 440 1.5e-25 PFAM
Meta Mutation Damage Score 0.0579 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik C T 7: 126,831,490 probably benign Het
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
Akap13 T A 7: 75,611,285 I1219K probably damaging Het
Arfgef1 T C 1: 10,159,546 probably benign Het
Arhgap24 A G 5: 102,664,117 E70G probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Babam2 T C 5: 31,702,070 S40P possibly damaging Het
Brwd1 A G 16: 96,023,496 V1190A probably damaging Het
Ccpg1 A G 9: 73,012,627 E508G probably damaging Het
Ckm T C 7: 19,421,354 S372P probably benign Het
Egflam T A 15: 7,254,426 probably null Het
Farp1 G A 14: 121,255,479 V498M probably benign Het
Galnt14 T A 17: 73,504,904 I441F probably benign Het
Gm5414 A G 15: 101,624,672 L440P probably damaging Het
Gm6563 A G 19: 23,675,975 E43G possibly damaging Het
Gmds A G 13: 31,820,189 S337P possibly damaging Het
L3mbtl3 T A 10: 26,280,122 Q754L unknown Het
Ltk G A 2: 119,753,004 T300I possibly damaging Het
Olfr1176 A C 2: 88,340,277 K237N probably damaging Het
Pbx2 C A 17: 34,594,645 H184Q probably damaging Het
Plxna2 T C 1: 194,644,775 F339S probably damaging Het
Prkaa2 A T 4: 105,039,956 D353E probably benign Het
Prss36 G A 7: 127,932,838 probably benign Het
Rimbp2 A G 5: 128,774,260 V874A probably damaging Het
Rspo2 C A 15: 43,075,911 R161L probably benign Het
Ryr1 T C 7: 29,082,450 D2038G possibly damaging Het
Stkld1 A G 2: 26,943,134 M111V probably benign Het
Tprn A G 2: 25,264,482 I599V probably damaging Het
Upp2 A T 2: 58,780,094 I219F probably damaging Het
Vmn2r94 A T 17: 18,244,171 F619Y probably damaging Het
Xirp2 A G 2: 67,516,039 T2875A probably benign Het
Zfp64 A G 2: 168,926,378 L438P probably damaging Het
Other mutations in Gm9755
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Gm9755 APN 8 67515233 exon noncoding transcript
IGL03217:Gm9755 APN 8 67514383 exon noncoding transcript
IGL03229:Gm9755 APN 8 67514672 exon noncoding transcript
R1110:Gm9755 UTSW 8 67515058 exon noncoding transcript
R1630:Gm9755 UTSW 8 67514660 exon noncoding transcript
R4743:Gm9755 UTSW 8 67514277 exon noncoding transcript
R5960:Gm9755 UTSW 8 67515188 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGGTACATCAGTAACAAGGCC -3'
(R):5'- GATGTTCCACAAGAGCCTGG -3'

Sequencing Primer
(F):5'- GCCAGTGCCAATGGTCTTG -3'
(R):5'- TTCCACAAGAGCCTGGAGAGG -3'
Posted On2015-06-20