Incidental Mutation 'R4451:Dnajc2'
ID328958
Institutional Source Beutler Lab
Gene Symbol Dnajc2
Ensembl Gene ENSMUSG00000029014
Gene NameDnaJ heat shock protein family (Hsp40) member C2
SynonymsMIDA1, Zrf1, Mida1, Zrf2
MMRRC Submission 041712-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R4451 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location21757267-21785251 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21757794 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 588 (T588A)
Ref Sequence ENSEMBL: ENSMUSP00000110847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030771] [ENSMUST00000030882] [ENSMUST00000115193] [ENSMUST00000115195]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030771
AA Change: T588A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030771
Gene: ENSMUSG00000029014
AA Change: T588A

DomainStartEndE-ValueType
coiled coil region 39 67 N/A INTRINSIC
DnaJ 87 153 2.16e-18 SMART
low complexity region 231 245 N/A INTRINSIC
low complexity region 281 319 N/A INTRINSIC
Pfam:RAC_head 339 430 2.8e-24 PFAM
SANT 450 509 6.64e-10 SMART
SANT 550 602 2.4e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030882
SMART Domains Protein: ENSMUSP00000030882
Gene: ENSMUSG00000029017

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:Peptidase_M16 68 215 6.1e-59 PFAM
Pfam:Peptidase_M16_C 220 404 4.1e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115193
AA Change: T588A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110847
Gene: ENSMUSG00000029014
AA Change: T588A

DomainStartEndE-ValueType
coiled coil region 39 67 N/A INTRINSIC
DnaJ 87 153 2.16e-18 SMART
coiled coil region 230 358 N/A INTRINSIC
coiled coil region 404 445 N/A INTRINSIC
SANT 450 509 6.64e-10 SMART
SANT 550 602 1.34e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115195
AA Change: T514A

PolyPhen 2 Score 0.309 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110849
Gene: ENSMUSG00000029014
AA Change: T514A

DomainStartEndE-ValueType
DnaJ 13 79 2.16e-18 SMART
coiled coil region 156 284 N/A INTRINSIC
coiled coil region 330 371 N/A INTRINSIC
SANT 376 435 6.64e-10 SMART
SANT 476 528 2.4e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137334
Predicted Effect probably benign
Transcript: ENSMUST00000141022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152440
Meta Mutation Damage Score 0.4267 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the M-phase phosphoprotein (MPP) family. The gene encodes a phosphoprotein with a J domain and a Myb DNA-binding domain which localizes to both the nucleus and the cytosol. The protein is capable of forming a heterodimeric complex that associates with ribosomes, acting as a molecular chaperone for nascent polypeptide chains as they exit the ribosome. This protein was identified as a leukemia-associated antigen and expression of the gene is upregulated in leukemic blasts. Also, chromosomal aberrations involving this gene are associated with primary head and neck squamous cell tumors. This gene has a pseudogene on chromosome 6. Alternatively spliced variants which encode different protein isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 A C 5: 62,749,170 F169V probably benign Het
Baiap2l1 T A 5: 144,278,552 Y381F probably damaging Het
Cdc27 A T 11: 104,517,395 M563K probably benign Het
Cela3b G A 4: 137,421,044 probably benign Het
Cyp2c29 A T 19: 39,290,826 D50V probably damaging Het
Dbpht2 A T 12: 74,299,032 noncoding transcript Het
Dnah9 T A 11: 65,881,641 Q3755L probably benign Het
Dync2h1 T A 9: 6,983,477 R4022S probably benign Het
Gm20481 T G 17: 34,972,133 probably benign Het
Gm7347 A G 5: 26,055,006 I182T possibly damaging Het
Gns G A 10: 121,376,696 G188S probably damaging Het
Grm5 T G 7: 88,075,132 probably null Het
Gstm4 T C 3: 108,043,975 probably null Het
Il7r T A 15: 9,512,948 K158N probably benign Het
Irs1 T C 1: 82,289,028 Y489C probably benign Het
Kcns1 C T 2: 164,168,678 E54K possibly damaging Het
Klra5 T A 6: 129,908,834 R31* probably null Het
Krt13 T C 11: 100,118,001 T409A unknown Het
Lce1e C T 3: 92,707,660 G127S unknown Het
Mfsd14a T C 3: 116,662,478 M1V probably null Het
Micall2 T C 5: 139,707,097 E891G probably damaging Het
Mpeg1 A T 19: 12,463,232 K685* probably null Het
Nbea A G 3: 55,992,332 probably null Het
Nup155 A G 15: 8,150,882 M1148V probably benign Het
Olfr1033 T C 2: 86,041,959 S215P probably damaging Het
Olfr611 A G 7: 103,517,977 S136P probably damaging Het
Otof T A 5: 30,385,164 D695V possibly damaging Het
Ptf1a G T 2: 19,446,281 A141S possibly damaging Het
Pxmp2 A T 5: 110,277,665 V168E probably damaging Het
Rab11fip1 T C 8: 27,154,477 K427E probably damaging Het
Susd2 A G 10: 75,639,398 V526A probably damaging Het
Tbx2 T C 11: 85,840,817 S647P probably damaging Het
Tg A G 15: 66,766,147 T651A probably benign Het
Trim68 T A 7: 102,684,473 M1L probably damaging Het
Ttn A C 2: 76,753,906 L20540* probably null Het
Usf3 A T 16: 44,217,888 K910N possibly damaging Het
Vmn1r14 T G 6: 57,234,228 Y220D possibly damaging Het
Vmn1r209 T A 13: 22,806,498 K7N probably benign Het
Other mutations in Dnajc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Dnajc2 APN 5 21774976 missense possibly damaging 0.83
IGL01479:Dnajc2 APN 5 21757893 missense probably damaging 1.00
IGL01804:Dnajc2 APN 5 21757363 missense probably damaging 1.00
IGL02478:Dnajc2 APN 5 21776790 missense probably damaging 1.00
IGL02552:Dnajc2 APN 5 21783063 missense probably damaging 1.00
IGL02657:Dnajc2 APN 5 21770481 splice site probably benign
IGL02832:Dnajc2 APN 5 21760410 missense probably benign
IGL03177:Dnajc2 APN 5 21775081 splice site probably benign
R1914:Dnajc2 UTSW 5 21781319 critical splice donor site probably null
R1915:Dnajc2 UTSW 5 21781319 critical splice donor site probably null
R2024:Dnajc2 UTSW 5 21776790 missense probably damaging 1.00
R2437:Dnajc2 UTSW 5 21760391 missense probably benign 0.06
R4177:Dnajc2 UTSW 5 21757396 missense probably benign 0.28
R4812:Dnajc2 UTSW 5 21763486 missense probably benign 0.03
R4916:Dnajc2 UTSW 5 21757340 missense probably damaging 1.00
R5013:Dnajc2 UTSW 5 21757773 nonsense probably null
R5094:Dnajc2 UTSW 5 21776732 missense probably damaging 1.00
R5124:Dnajc2 UTSW 5 21763484 missense probably benign
R5891:Dnajc2 UTSW 5 21761711 missense possibly damaging 0.67
R6192:Dnajc2 UTSW 5 21768648 missense probably damaging 1.00
R6567:Dnajc2 UTSW 5 21766678 missense probably damaging 1.00
R7211:Dnajc2 UTSW 5 21776779 missense probably damaging 1.00
R7216:Dnajc2 UTSW 5 21776779 missense probably damaging 1.00
R7418:Dnajc2 UTSW 5 21760624 critical splice donor site probably null
R7728:Dnajc2 UTSW 5 21770540 missense possibly damaging 0.62
R7877:Dnajc2 UTSW 5 21760639 missense possibly damaging 0.88
R8156:Dnajc2 UTSW 5 21781319 critical splice donor site probably null
R8231:Dnajc2 UTSW 5 21761691 missense probably benign 0.00
R8360:Dnajc2 UTSW 5 21757707 missense unknown
R8880:Dnajc2 UTSW 5 21768672 missense probably damaging 1.00
RF040:Dnajc2 UTSW 5 21757697 makesense probably null
X0027:Dnajc2 UTSW 5 21773811 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CCAGGGATAAGGCTGGTCTTAC -3'
(R):5'- CCACTTGATAGGGAAATGGGAGTC -3'

Sequencing Primer
(F):5'- CAGGGATAAGGCTGGTCTTACTTTCC -3'
(R):5'- TGAAAAACATGCTTCACTATCACTTC -3'
Posted On2015-07-21