Incidental Mutation 'R4493:Tma16'
List |< first << previous [record 36 of 41] next >> last >|
ID330835
Institutional Source Beutler Lab
Gene Symbol Tma16
Ensembl Gene ENSMUSG00000025591
Gene Nametranslation machinery associated 16
Synonyms
MMRRC Submission 041748-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock #R4493 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location66473118-66486530 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) C to T at 66484171 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026681] [ENSMUST00000143972]
Predicted Effect probably null
Transcript: ENSMUST00000026681
SMART Domains Protein: ENSMUSP00000026681
Gene: ENSMUSG00000025591

DomainStartEndE-ValueType
Pfam:DUF2962 10 162 1.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213036
Meta Mutation Damage Score 0.9588 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 94% (45/48)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1b T C 2: 24,652,938 T1301A probably damaging Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Ccdc146 T C 5: 21,303,193 E619G possibly damaging Het
Cmya5 T C 13: 93,094,065 E1505G probably benign Het
Cngb3 C A 4: 19,367,778 P229Q probably damaging Het
Ctnna2 A G 6: 76,981,848 V461A probably damaging Het
D430041D05Rik T C 2: 104,256,339 D764G probably benign Het
Dgki T C 6: 36,974,861 probably benign Het
Dhx36 A T 3: 62,488,504 probably benign Het
Gcn1l1 T C 5: 115,594,144 I1006T probably benign Het
Glt8d2 T A 10: 82,664,713 M20L possibly damaging Het
Greb1 C A 12: 16,698,610 G1122V probably benign Het
Hmcn1 A T 1: 150,701,899 I2037N probably damaging Het
Hspa4l A G 3: 40,768,002 I340V possibly damaging Het
Itpr3 A G 17: 27,104,612 K1204E probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Maats1 T C 16: 38,341,768 T4A probably benign Het
Mcph1 T A 8: 18,631,736 C296* probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Naga A G 15: 82,332,514 F259S probably damaging Het
Nes A G 3: 87,976,813 E793G probably damaging Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Pcdha4 A T 18: 36,954,591 Y609F possibly damaging Het
Pgam1 C T 19: 41,915,776 A104V possibly damaging Het
Piezo2 T C 18: 63,114,063 I525V probably damaging Het
Pold1 A G 7: 44,537,708 V683A probably damaging Het
Poteg T C 8: 27,480,097 V316A possibly damaging Het
Ppih A T 4: 119,310,845 N156K probably damaging Het
Prep T C 10: 45,120,819 F398L probably benign Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Rtp4 A T 16: 23,610,077 H30L probably benign Het
Stkld1 A G 2: 26,946,626 N268S probably benign Het
Syt6 A G 3: 103,585,630 E66G probably damaging Het
Tas2r129 A G 6: 132,951,354 I85V probably benign Het
Tprn T C 2: 25,268,892 S643P probably damaging Het
Trrap T C 5: 144,831,048 V2605A probably benign Het
Vmn1r230 T A 17: 20,846,601 N17K probably benign Het
Xkrx T C X: 134,150,996 N302S possibly damaging Het
Zfp946 T A 17: 22,451,086 probably null Het
Other mutations in Tma16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Tma16 APN 8 66480445 missense probably benign 0.00
IGL01321:Tma16 APN 8 66476860 missense probably benign 0.02
IGL02022:Tma16 APN 8 66486410 critical splice donor site probably null
R0064:Tma16 UTSW 8 66476805 missense possibly damaging 0.46
R3401:Tma16 UTSW 8 66484171 critical splice acceptor site probably null
R3402:Tma16 UTSW 8 66484171 critical splice acceptor site probably null
R3403:Tma16 UTSW 8 66484171 critical splice acceptor site probably null
R4399:Tma16 UTSW 8 66484171 critical splice acceptor site probably null
R4402:Tma16 UTSW 8 66484171 critical splice acceptor site probably null
R4421:Tma16 UTSW 8 66484171 critical splice acceptor site probably null
R4453:Tma16 UTSW 8 66484171 critical splice acceptor site probably null
R4856:Tma16 UTSW 8 66481477 missense probably damaging 1.00
R4886:Tma16 UTSW 8 66481477 missense probably damaging 1.00
R5527:Tma16 UTSW 8 66484124 missense possibly damaging 0.94
R6312:Tma16 UTSW 8 66481466 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATGCATAAAGGCGCTTTCC -3'
(R):5'- GTCAGAACTACTTTAAGCTGGC -3'

Sequencing Primer
(F):5'- ATAAAGGCGCTTTCCCCAGTG -3'
(R):5'- CAGAACTACTTTAAGCTGGCATGGC -3'
Posted On2015-07-21