Mutagenetix > Incidental Mutation

Incidental Mutation 'R4493:Syt6'

330822

Institutional Source

Beutler Lab

Gene Symbol

Syt6

Ensembl Gene

ENSMUSG00000027849

Gene Name

synaptotagmin VI

Synonyms

3110037A08Rik

MMRRC Submission

041748-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.103) question?

Stock #

R4493 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103575231-103645569 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 103585630 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 66 (E66G)

Ref Sequence

ENSEMBL: ENSMUSP00000138874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090697] [ENSMUST00000117221] [ENSMUST00000118117] [ENSMUST00000118563] [ENSMUST00000121834] [ENSMUST00000132325] [ENSMUST00000136049] [ENSMUST00000151985] [ENSMUST00000183637]

AlphaFold

Q9R0N8

Predicted Effect

probably benign
Transcript: ENSMUST00000090697
AA Change: E151G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000088196
Gene: ENSMUSG00000027849
AA Change: E151G

Domain	Start	End	E-Value	Type
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	93	103	N/A	INTRINSIC
C2	246	350	2.65e-20	SMART
C2	378	492	2.25e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117221
AA Change: E66G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000113373
Gene: ENSMUSG00000027849
AA Change: E66G

Domain	Start	End	E-Value	Type
low complexity region	8	18	N/A	INTRINSIC
C2	161	265	2.65e-20	SMART
C2	293	407	2.25e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000118117
AA Change: E66G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000112486
Gene: ENSMUSG00000027849
AA Change: E66G

Domain	Start	End	E-Value	Type
low complexity region	8	18	N/A	INTRINSIC
C2	161	265	2.65e-20	SMART
C2	293	407	2.25e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000118563
AA Change: E66G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000113287
Gene: ENSMUSG00000027849
AA Change: E66G

Domain	Start	End	E-Value	Type
low complexity region	8	18	N/A	INTRINSIC
C2	161	265	2.65e-20	SMART
Pfam:C2	294	332	3.5e-2	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000121834
AA Change: E151G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000112997
Gene: ENSMUSG00000027849
AA Change: E151G

Domain	Start	End	E-Value	Type
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	93	103	N/A	INTRINSIC
C2	246	350	2.65e-20	SMART
C2	378	492	2.25e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000132325

SMART Domains

Protein: ENSMUSP00000116324
Gene: ENSMUSG00000027849

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136049

SMART Domains

Protein: ENSMUSP00000118124
Gene: ENSMUSG00000027849

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000151985

Predicted Effect

probably damaging
Transcript: ENSMUST00000183637
AA Change: E66G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000138874
Gene: ENSMUSG00000027849
AA Change: E66G

Domain	Start	End	E-Value	Type
low complexity region	8	18	N/A	INTRINSIC

Meta Mutation Damage Score

0.1059

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

94% (45/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the synaptotagmin family. Synaptotagmins share a common domain structure that includes a transmembrane domain and a cytoplasmic region composed of 2 C2 domains, and are involved in calcium-dependent exocytosis of synaptic vesicles. This protein has been shown to be a key component of the secretory machinery involved in acrosomal exocytosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cacna1b	T	C	2: 24,652,938	T1301A	probably damaging	Het
Ccdc141	A	G	2: 77,132,297	V101A	probably damaging	Het
Ccdc146	T	C	5: 21,303,193	E619G	possibly damaging	Het
Cmya5	T	C	13: 93,094,065	E1505G	probably benign	Het
Cngb3	C	A	4: 19,367,778	P229Q	probably damaging	Het
Ctnna2	A	G	6: 76,981,848	V461A	probably damaging	Het
D430041D05Rik	T	C	2: 104,256,339	D764G	probably benign	Het
Dgki	T	C	6: 36,974,861		probably benign	Het
Dhx36	A	T	3: 62,488,504		probably benign	Het
Gcn1l1	T	C	5: 115,594,144	I1006T	probably benign	Het
Glt8d2	T	A	10: 82,664,713	M20L	possibly damaging	Het
Greb1	C	A	12: 16,698,610	G1122V	probably benign	Het
Hmcn1	A	T	1: 150,701,899	I2037N	probably damaging	Het
Hspa4l	A	G	3: 40,768,002	I340V	possibly damaging	Het
Itpr3	A	G	17: 27,104,612	K1204E	probably damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Lyst	G	A	13: 13,635,383	R546H	probably damaging	Het
Maats1	T	C	16: 38,341,768	T4A	probably benign	Het
Mcph1	T	A	8: 18,631,736	C296*	probably null	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Naga	A	G	15: 82,332,514	F259S	probably damaging	Het
Nes	A	G	3: 87,976,813	E793G	probably damaging	Het
Nfkb2	A	G	19: 46,308,439	D316G	probably damaging	Het
Pcdha4	A	T	18: 36,954,591	Y609F	possibly damaging	Het
Pgam1	C	T	19: 41,915,776	A104V	possibly damaging	Het
Piezo2	T	C	18: 63,114,063	I525V	probably damaging	Het
Pold1	A	G	7: 44,537,708	V683A	probably damaging	Het
Poteg	T	C	8: 27,480,097	V316A	possibly damaging	Het
Ppih	A	T	4: 119,310,845	N156K	probably damaging	Het
Prep	T	C	10: 45,120,819	F398L	probably benign	Het
Prlhr	A	T	19: 60,467,081	M349K	probably benign	Het
Rtp4	A	T	16: 23,610,077	H30L	probably benign	Het
Stkld1	A	G	2: 26,946,626	N268S	probably benign	Het
Tas2r129	A	G	6: 132,951,354	I85V	probably benign	Het
Tma16	C	T	8: 66,484,171		probably null	Het
Tprn	T	C	2: 25,268,892	S643P	probably damaging	Het
Trrap	T	C	5: 144,831,048	V2605A	probably benign	Het
Vmn1r230	T	A	17: 20,846,601	N17K	probably benign	Het
Xkrx	T	C	X: 134,150,996	N302S	possibly damaging	Het
Zfp946	T	A	17: 22,451,086		probably null	Het

Other mutations in Syt6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Syt6	APN	3	103625626	missense	probably damaging	0.98
IGL02944:Syt6	APN	3	103575549	unclassified	probably benign
IGL03168:Syt6	APN	3	103587627	missense	probably damaging	1.00
PIT4305001:Syt6	UTSW	3	103575453	missense	possibly damaging	0.91
R0124:Syt6	UTSW	3	103587526	missense	probably damaging	1.00
R0587:Syt6	UTSW	3	103625571	missense	probably damaging	0.99
R0601:Syt6	UTSW	3	103620890	missense	probably damaging	1.00
R1262:Syt6	UTSW	3	103585340	critical splice acceptor site	probably null
R1970:Syt6	UTSW	3	103587420	missense	probably benign	0.21
R4012:Syt6	UTSW	3	103625493	splice site	probably benign
R4450:Syt6	UTSW	3	103585645	missense	probably benign	0.01
R4494:Syt6	UTSW	3	103585630	missense	probably damaging	0.99
R4495:Syt6	UTSW	3	103587560	nonsense	probably null
R4740:Syt6	UTSW	3	103625656	missense	probably damaging	1.00
R4750:Syt6	UTSW	3	103630917	makesense	probably null
R5668:Syt6	UTSW	3	103620901	missense	probably damaging	1.00
R6185:Syt6	UTSW	3	103585528	missense	probably damaging	1.00
R6660:Syt6	UTSW	3	103625644	missense	probably damaging	1.00
R7120:Syt6	UTSW	3	103587357	missense	probably damaging	1.00
R7307:Syt6	UTSW	3	103587472	missense	probably damaging	1.00
R7501:Syt6	UTSW	3	103587702	missense	probably benign	0.01
R8768:Syt6	UTSW	3	103585534	missense	probably benign
R8867:Syt6	UTSW	3	103627055	missense	possibly damaging	0.91
R8885:Syt6	UTSW	3	103625625	missense	probably benign	0.06
R9068:Syt6	UTSW	3	103587509	nonsense	probably null
R9098:Syt6	UTSW	3	103585579	missense	probably damaging	0.96
R9361:Syt6	UTSW	3	103575363	unclassified	probably benign
Z1177:Syt6	UTSW	3	103645115	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CCTCGCCGTGGTAGTTATTG -3'
(R):5'- TTAGTTCTGGGCCCTGATCC -3'

Sequencing Primer
(F):5'- AAGCTGTGCTGGATGCC -3'
(R):5'- ATCCTCAGGGGCTGGGATCTAC -3'

Posted On

2015-07-21