Incidental Mutation 'R4524:Cavin2'
ID334342
Institutional Source Beutler Lab
Gene Symbol Cavin2
Ensembl Gene ENSMUSG00000045954
Gene Namecaveolae associated 2
SynonymsSdpr, cavin 2
MMRRC Submission 041766-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R4524 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location51289126-51302960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51301070 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 302 (V302A)
Ref Sequence ENSEMBL: ENSMUSP00000055694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051572]
Predicted Effect probably benign
Transcript: ENSMUST00000051572
AA Change: V302A

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000055694
Gene: ENSMUSG00000045954
AA Change: V302A

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
Pfam:PTRF_SDPR 52 294 3.8e-96 PFAM
low complexity region 370 376 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189867
Meta Mutation Damage Score 0.0923 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium-independent phospholipid-binding protein whose expression increases in serum-starved cells. This protein is a substrate for protein kinase C (PKC) phosphorylation and recruits polymerase I and transcript release factor (PTRF) to caveolae. Removal of this protein causes caveolae loss and its over-expression results in caveolae deformation and membrane tubulation.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal caveolae formation in lung and adipose endothelia and adipocytes with gaps in the lung capillaries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,302,917 S962G probably benign Het
Ackr2 T C 9: 121,909,543 V328A probably benign Het
Ang4 G T 14: 51,764,148 C114* probably null Het
Arid1b A T 17: 5,097,620 Q599L possibly damaging Het
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Atrnl1 A G 19: 57,630,306 D152G probably damaging Het
BC017643 A G 11: 121,224,108 probably benign Het
Birc6 C T 17: 74,641,777 T3067I probably damaging Het
Bmpr2 T C 1: 59,867,412 S555P probably benign Het
Brox A T 1: 183,292,481 L68I possibly damaging Het
C130026L21Rik A G 5: 111,585,872 noncoding transcript Het
Cbln3 A T 14: 55,884,065 C41* probably null Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Clec4a2 T A 6: 123,125,084 I66N probably damaging Het
Ddx27 T A 2: 167,027,720 C358* probably null Het
Ehbp1 A T 11: 22,151,843 D228E probably damaging Het
Emc7 T C 2: 112,455,264 V66A probably damaging Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Furin T C 7: 80,398,634 probably null Het
Gm3739 T A 14: 7,299,398 K86* probably null Het
Gmpr A T 13: 45,529,739 E162V probably damaging Het
Gtpbp4 A T 13: 8,974,294 V541D probably benign Het
Myh2 G T 11: 67,176,270 G184W probably damaging Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nrg4 T G 9: 55,227,902 probably benign Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfr298 G T 7: 86,488,826 H242N probably damaging Het
Olfr874 T C 9: 37,746,866 L244S possibly damaging Het
Pde7a T A 3: 19,230,976 H349L possibly damaging Het
Pds5b A T 5: 150,788,316 D913V probably damaging Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Ralgapb C A 2: 158,437,306 T104N probably benign Het
Rapgef1 A G 2: 29,679,246 I59V probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Rsph6a C T 7: 19,066,045 H534Y probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shcbp1 T C 8: 4,739,193 Y542C probably damaging Het
Shisa8 C G 15: 82,211,962 V151L possibly damaging Het
Slc7a8 G A 14: 54,737,602 T190I probably damaging Het
Spire2 T A 8: 123,360,235 S382T probably benign Het
Stard9 A G 2: 120,696,445 D1061G probably damaging Het
Tex44 T G 1: 86,427,576 D402E probably benign Het
Thbs1 G T 2: 118,122,979 R959L probably damaging Het
Tiam2 A G 17: 3,514,711 D1408G probably damaging Het
Trrap C T 5: 144,825,321 T2352I probably benign Het
Tspyl5 T A 15: 33,687,592 E69V probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Washc1 C T 17: 66,119,092 Q462* probably null Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Other mutations in Cavin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Cavin2 APN 1 51300877 missense probably damaging 1.00
IGL01951:Cavin2 APN 1 51289411 missense possibly damaging 0.82
R1649:Cavin2 UTSW 1 51300780 missense probably benign 0.09
R1676:Cavin2 UTSW 1 51301171 missense probably benign 0.05
R1966:Cavin2 UTSW 1 51289642 missense probably damaging 1.00
R3038:Cavin2 UTSW 1 51301257 missense possibly damaging 0.95
R3440:Cavin2 UTSW 1 51301406 missense probably damaging 1.00
R4128:Cavin2 UTSW 1 51301422 makesense probably null
R4660:Cavin2 UTSW 1 51301351 missense probably benign 0.00
R4662:Cavin2 UTSW 1 51301351 missense probably benign 0.00
R5091:Cavin2 UTSW 1 51301239 missense probably benign 0.01
R5296:Cavin2 UTSW 1 51289870 critical splice donor site probably null
R5844:Cavin2 UTSW 1 51289839 missense probably damaging 1.00
R6141:Cavin2 UTSW 1 51300938 missense probably damaging 1.00
R6177:Cavin2 UTSW 1 51289495 missense probably damaging 1.00
R6252:Cavin2 UTSW 1 51289669 missense probably benign 0.30
R7128:Cavin2 UTSW 1 51289420 missense possibly damaging 0.57
R7583:Cavin2 UTSW 1 51289618 missense possibly damaging 0.93
R8051:Cavin2 UTSW 1 51301124 missense probably benign
X0028:Cavin2 UTSW 1 51301102 missense probably benign 0.07
Z1176:Cavin2 UTSW 1 51301156 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCCTCAAGAAAGTCGATAGCC -3'
(R):5'- TCAGATCCGCATTACTGCCC -3'

Sequencing Primer
(F):5'- GTCGATAGCCTCAAGAAAGCGTTTTC -3'
(R):5'- CCCACGGCTGAGTTGTTC -3'
Posted On2015-08-18