Incidental Mutation 'R3038:Cavin2'
ID 264872
Institutional Source Beutler Lab
Gene Symbol Cavin2
Ensembl Gene ENSMUSG00000045954
Gene Name caveolae associated 2
Synonyms cavin 2, Sdpr
MMRRC Submission 040554-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.153) question?
Stock # R3038 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 51328285-51342119 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 51340416 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 364 (N364K)
Ref Sequence ENSEMBL: ENSMUSP00000055694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051572]
AlphaFold Q63918
Predicted Effect possibly damaging
Transcript: ENSMUST00000051572
AA Change: N364K

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055694
Gene: ENSMUSG00000045954
AA Change: N364K

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
Pfam:PTRF_SDPR 52 294 3.8e-96 PFAM
low complexity region 370 376 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189867
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium-independent phospholipid-binding protein whose expression increases in serum-starved cells. This protein is a substrate for protein kinase C (PKC) phosphorylation and recruits polymerase I and transcript release factor (PTRF) to caveolae. Removal of this protein causes caveolae loss and its over-expression results in caveolae deformation and membrane tubulation.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal caveolae formation in lung and adipose endothelia and adipocytes with gaps in the lung capillaries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bspry A G 4: 62,415,220 (GRCm39) I468V probably benign Het
Ces1f T A 8: 93,983,226 (GRCm39) N506I probably damaging Het
Dnhd1 A T 7: 105,369,436 (GRCm39) Q4353L probably damaging Het
Dsc3 T C 18: 20,124,617 (GRCm39) T36A possibly damaging Het
Hydin A G 8: 111,309,321 (GRCm39) T4038A probably damaging Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Kif1b T C 4: 149,297,790 (GRCm39) I1083V probably benign Het
Lmo2 T C 2: 103,811,407 (GRCm39) Y147H probably damaging Het
Mrgpra1 G A 7: 46,984,744 (GRCm39) Q312* probably null Het
Pcdha1 T A 18: 37,064,064 (GRCm39) F243I probably damaging Het
Ppp1r18 T C 17: 36,179,274 (GRCm39) L383P probably damaging Het
Tmed9 A G 13: 55,744,792 (GRCm39) K207E probably damaging Het
Tnfrsf19 A G 14: 61,209,512 (GRCm39) S253P probably benign Het
Tspear T A 10: 77,722,273 (GRCm39) Y624* probably null Het
Vmn2r16 G A 5: 109,487,199 (GRCm39) C140Y probably damaging Het
Vwa7 T C 17: 35,241,637 (GRCm39) V424A probably damaging Het
Zgpat TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 2: 181,007,811 (GRCm39) probably benign Het
Other mutations in Cavin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Cavin2 APN 1 51,340,036 (GRCm39) missense probably damaging 1.00
IGL01951:Cavin2 APN 1 51,328,570 (GRCm39) missense possibly damaging 0.82
R1649:Cavin2 UTSW 1 51,339,939 (GRCm39) missense probably benign 0.09
R1676:Cavin2 UTSW 1 51,340,330 (GRCm39) missense probably benign 0.05
R1966:Cavin2 UTSW 1 51,328,801 (GRCm39) missense probably damaging 1.00
R3440:Cavin2 UTSW 1 51,340,565 (GRCm39) missense probably damaging 1.00
R4128:Cavin2 UTSW 1 51,340,581 (GRCm39) makesense probably null
R4524:Cavin2 UTSW 1 51,340,229 (GRCm39) missense probably benign 0.25
R4660:Cavin2 UTSW 1 51,340,510 (GRCm39) missense probably benign 0.00
R4662:Cavin2 UTSW 1 51,340,510 (GRCm39) missense probably benign 0.00
R5091:Cavin2 UTSW 1 51,340,398 (GRCm39) missense probably benign 0.01
R5296:Cavin2 UTSW 1 51,329,029 (GRCm39) critical splice donor site probably null
R5844:Cavin2 UTSW 1 51,328,998 (GRCm39) missense probably damaging 1.00
R6141:Cavin2 UTSW 1 51,340,097 (GRCm39) missense probably damaging 1.00
R6177:Cavin2 UTSW 1 51,328,654 (GRCm39) missense probably damaging 1.00
R6252:Cavin2 UTSW 1 51,328,828 (GRCm39) missense probably benign 0.30
R7128:Cavin2 UTSW 1 51,328,579 (GRCm39) missense possibly damaging 0.57
R7583:Cavin2 UTSW 1 51,328,777 (GRCm39) missense possibly damaging 0.93
R8051:Cavin2 UTSW 1 51,340,283 (GRCm39) missense probably benign
R9573:Cavin2 UTSW 1 51,328,795 (GRCm39) missense probably damaging 0.99
X0028:Cavin2 UTSW 1 51,340,261 (GRCm39) missense probably benign 0.07
Z1176:Cavin2 UTSW 1 51,340,315 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCATCTTCTGGGAAAAGCTCC -3'
(R):5'- TGTTCTGGCTGTGCACTCAG -3'

Sequencing Primer
(F):5'- GAAAAGCTCCCCCTTCAAGGTTTC -3'
(R):5'- TCAGGCAGTCTGATCCACATG -3'
Posted On 2015-02-05