Incidental Mutation 'R5296:Cavin2'
ID405385
Institutional Source Beutler Lab
Gene Symbol Cavin2
Ensembl Gene ENSMUSG00000045954
Gene Namecaveolae associated 2
SynonymsSdpr, cavin 2
MMRRC Submission 042879-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R5296 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location51289126-51302960 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 51289870 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000055694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051572]
Predicted Effect probably null
Transcript: ENSMUST00000051572
SMART Domains Protein: ENSMUSP00000055694
Gene: ENSMUSG00000045954

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
Pfam:PTRF_SDPR 52 294 3.8e-96 PFAM
low complexity region 370 376 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189867
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium-independent phospholipid-binding protein whose expression increases in serum-starved cells. This protein is a substrate for protein kinase C (PKC) phosphorylation and recruits polymerase I and transcript release factor (PTRF) to caveolae. Removal of this protein causes caveolae loss and its over-expression results in caveolae deformation and membrane tubulation.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal caveolae formation in lung and adipose endothelia and adipocytes with gaps in the lung capillaries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobr A C 7: 126,588,024 D89A probably damaging Het
Bhlhe41 C T 6: 145,862,968 probably benign Het
Cacna1s G A 1: 136,095,785 V674M probably benign Het
Cd300lb T C 11: 114,924,937 S106G possibly damaging Het
Ceacam15 A G 7: 16,673,196 V132A probably benign Het
Ddi2 G T 4: 141,684,765 Q279K probably benign Het
Dnah11 A G 12: 117,883,416 V4304A probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epsti1 T A 14: 77,904,650 H55Q probably benign Het
Flad1 T C 3: 89,411,196 T17A probably damaging Het
Fzd2 C T 11: 102,606,155 T475M probably damaging Het
Gemin5 C A 11: 58,130,061 W1099L probably damaging Het
Gm8979 A T 7: 106,081,848 noncoding transcript Het
Gm9892 T C 8: 52,196,929 noncoding transcript Het
Gmeb2 A G 2: 181,255,986 probably benign Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Hltf T C 3: 20,108,112 S825P probably damaging Het
Kcnh3 A T 15: 99,241,939 Q902L probably null Het
Kcnt2 C T 1: 140,609,615 P1037L probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lama5 A C 2: 180,193,801 L1253R probably damaging Het
Lancl2 T G 6: 57,724,582 S230A probably benign Het
Lmcd1 A G 6: 112,315,588 M134V probably damaging Het
Lrrc23 C A 6: 124,774,482 A205S probably damaging Het
Mfsd13b T A 7: 120,991,738 I234N probably damaging Het
Mroh3 A G 1: 136,196,323 S386P probably damaging Het
Mylk3 A C 8: 85,355,431 F313V possibly damaging Het
Myo9b A T 8: 71,333,388 Q643L possibly damaging Het
Nacad T C 11: 6,605,745 S2G unknown Het
Olfr1269 A T 2: 90,118,699 W300R probably damaging Het
Olfr136 C T 17: 38,335,456 Q100* probably null Het
Olfr419 G T 1: 174,250,756 T57K possibly damaging Het
Olfr908 T C 9: 38,516,116 F28S probably damaging Het
Pkd1 T C 17: 24,576,074 V2245A probably damaging Het
Pkdrej G A 15: 85,817,118 T1539I possibly damaging Het
Plch2 G T 4: 154,989,999 probably null Het
Pygm G A 19: 6,384,579 R34H probably damaging Het
Rgs12 T C 5: 35,021,104 probably benign Het
Ruvbl1 T C 6: 88,485,908 I338T probably damaging Het
Sapcd1 T A 17: 35,026,731 Q104L probably damaging Het
Satb2 T C 1: 56,796,907 E575G probably damaging Het
Sema6b T A 17: 56,127,091 probably null Het
Slc25a11 T C 11: 70,646,185 N15D probably damaging Het
Slc26a6 C T 9: 108,860,646 T526M probably damaging Het
Tcaf3 G T 6: 42,587,510 T906K possibly damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Traf2 A G 2: 25,520,440 L399P probably damaging Het
Troap T A 15: 99,078,817 V274D probably damaging Het
Utrn G A 10: 12,401,355 T3406M probably damaging Het
Uts2 G T 4: 150,999,051 A40S possibly damaging Het
Vmn2r109 T A 17: 20,554,341 I251F possibly damaging Het
Vmn2r67 A G 7: 85,137,022 S592P probably damaging Het
Vps13b T G 15: 35,876,413 W2797G probably damaging Het
Ythdf1 A T 2: 180,912,188 M51K probably damaging Het
Zfp60 T A 7: 27,738,530 probably benign Het
Zfp882 T A 8: 71,914,360 F344I probably damaging Het
Other mutations in Cavin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Cavin2 APN 1 51300877 missense probably damaging 1.00
IGL01951:Cavin2 APN 1 51289411 missense possibly damaging 0.82
R1649:Cavin2 UTSW 1 51300780 missense probably benign 0.09
R1676:Cavin2 UTSW 1 51301171 missense probably benign 0.05
R1966:Cavin2 UTSW 1 51289642 missense probably damaging 1.00
R3038:Cavin2 UTSW 1 51301257 missense possibly damaging 0.95
R3440:Cavin2 UTSW 1 51301406 missense probably damaging 1.00
R4128:Cavin2 UTSW 1 51301422 makesense probably null
R4524:Cavin2 UTSW 1 51301070 missense probably benign 0.25
R4660:Cavin2 UTSW 1 51301351 missense probably benign 0.00
R4662:Cavin2 UTSW 1 51301351 missense probably benign 0.00
R5091:Cavin2 UTSW 1 51301239 missense probably benign 0.01
R5844:Cavin2 UTSW 1 51289839 missense probably damaging 1.00
R6141:Cavin2 UTSW 1 51300938 missense probably damaging 1.00
R6177:Cavin2 UTSW 1 51289495 missense probably damaging 1.00
R6252:Cavin2 UTSW 1 51289669 missense probably benign 0.30
R7128:Cavin2 UTSW 1 51289420 missense possibly damaging 0.57
R7583:Cavin2 UTSW 1 51289618 missense possibly damaging 0.93
R8051:Cavin2 UTSW 1 51301124 missense probably benign
X0028:Cavin2 UTSW 1 51301102 missense probably benign 0.07
Z1176:Cavin2 UTSW 1 51301156 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAGCTCTCCAAGTACCAGGC -3'
(R):5'- TGACAAATGTCCCCAGCTTG -3'

Sequencing Primer
(F):5'- GTACCAGGCCTCCACCAG -3'
(R):5'- AATGTCCCCAGCTTGCCAGG -3'
Posted On2016-07-22