Incidental Mutation 'R4524:Bmpr2'
ID334343
Institutional Source Beutler Lab
Gene Symbol Bmpr2
Ensembl Gene ENSMUSG00000067336
Gene Namebone morphogenetic protein receptor, type II (serine/threonine kinase)
Synonyms2610024H22Rik, BMPRII, BMPR-II, BMP-2
MMRRC Submission 041766-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4524 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location59763400-59879014 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59867412 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 555 (S555P)
Ref Sequence ENSEMBL: ENSMUSP00000084701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087435]
Predicted Effect probably benign
Transcript: ENSMUST00000087435
AA Change: S555P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000084701
Gene: ENSMUSG00000067336
AA Change: S555P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Activin_recp 33 131 6.9e-17 PFAM
low complexity region 132 142 N/A INTRINSIC
transmembrane domain 152 174 N/A INTRINSIC
Pfam:Pkinase 203 501 6.6e-33 PFAM
Pfam:Pkinase_Tyr 203 501 1.3e-29 PFAM
low complexity region 545 558 N/A INTRINSIC
low complexity region 603 628 N/A INTRINSIC
low complexity region 694 710 N/A INTRINSIC
low complexity region 901 908 N/A INTRINSIC
Meta Mutation Damage Score 0.0766 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: This gene encodes a serine/threonine kinase that functions as a receptor for bone morphogenetic proteins (BMPs). The encoded protein is a type II receptor that binds extracellular BMPs and forms a complex of two type II and two type I receptors at the cell membrane. This complex signals downstream to activate SMAD transcriptional regulators. This signaling is important during embryonic development. Mutations in this gene can cause pulmonary hypertension. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous null mutants arrest at the egg cylinder stage and die before embryonic day 9.5 with failure to form organized structure and lacking mesoderm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,302,917 S962G probably benign Het
Ackr2 T C 9: 121,909,543 V328A probably benign Het
Ang4 G T 14: 51,764,148 C114* probably null Het
Arid1b A T 17: 5,097,620 Q599L possibly damaging Het
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Atrnl1 A G 19: 57,630,306 D152G probably damaging Het
BC017643 A G 11: 121,224,108 probably benign Het
Birc6 C T 17: 74,641,777 T3067I probably damaging Het
Brox A T 1: 183,292,481 L68I possibly damaging Het
C130026L21Rik A G 5: 111,585,872 noncoding transcript Het
Cavin2 T C 1: 51,301,070 V302A probably benign Het
Cbln3 A T 14: 55,884,065 C41* probably null Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Clec4a2 T A 6: 123,125,084 I66N probably damaging Het
Ddx27 T A 2: 167,027,720 C358* probably null Het
Ehbp1 A T 11: 22,151,843 D228E probably damaging Het
Emc7 T C 2: 112,455,264 V66A probably damaging Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Furin T C 7: 80,398,634 probably null Het
Gm3739 T A 14: 7,299,398 K86* probably null Het
Gmpr A T 13: 45,529,739 E162V probably damaging Het
Gtpbp4 A T 13: 8,974,294 V541D probably benign Het
Myh2 G T 11: 67,176,270 G184W probably damaging Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nrg4 T G 9: 55,227,902 probably benign Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfr298 G T 7: 86,488,826 H242N probably damaging Het
Olfr874 T C 9: 37,746,866 L244S possibly damaging Het
Pde7a T A 3: 19,230,976 H349L possibly damaging Het
Pds5b A T 5: 150,788,316 D913V probably damaging Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Ralgapb C A 2: 158,437,306 T104N probably benign Het
Rapgef1 A G 2: 29,679,246 I59V probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Rsph6a C T 7: 19,066,045 H534Y probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shcbp1 T C 8: 4,739,193 Y542C probably damaging Het
Shisa8 C G 15: 82,211,962 V151L possibly damaging Het
Slc7a8 G A 14: 54,737,602 T190I probably damaging Het
Spire2 T A 8: 123,360,235 S382T probably benign Het
Stard9 A G 2: 120,696,445 D1061G probably damaging Het
Tex44 T G 1: 86,427,576 D402E probably benign Het
Thbs1 G T 2: 118,122,979 R959L probably damaging Het
Tiam2 A G 17: 3,514,711 D1408G probably damaging Het
Trrap C T 5: 144,825,321 T2352I probably benign Het
Tspyl5 T A 15: 33,687,592 E69V probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Washc1 C T 17: 66,119,092 Q462* probably null Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Other mutations in Bmpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Bmpr2 APN 1 59815315 missense possibly damaging 0.88
IGL01366:Bmpr2 APN 1 59813677 missense probably damaging 1.00
IGL02281:Bmpr2 APN 1 59868344 missense probably damaging 1.00
IGL02531:Bmpr2 APN 1 59845714 splice site probably null
IGL03114:Bmpr2 APN 1 59867444 missense probably damaging 1.00
R0114:Bmpr2 UTSW 1 59815340 missense probably damaging 1.00
R0145:Bmpr2 UTSW 1 59867580 frame shift probably null
R0423:Bmpr2 UTSW 1 59868510 missense probably benign
R0480:Bmpr2 UTSW 1 59845659 missense probably damaging 1.00
R0556:Bmpr2 UTSW 1 59815328 missense probably damaging 1.00
R0597:Bmpr2 UTSW 1 59841425 splice site probably benign
R1167:Bmpr2 UTSW 1 59859304 missense probably damaging 1.00
R1537:Bmpr2 UTSW 1 59868126 missense probably benign 0.31
R1769:Bmpr2 UTSW 1 59868361 missense probably damaging 1.00
R1946:Bmpr2 UTSW 1 59868397 missense possibly damaging 0.83
R1972:Bmpr2 UTSW 1 59813603 missense possibly damaging 0.55
R4558:Bmpr2 UTSW 1 59845692 missense probably damaging 0.99
R4667:Bmpr2 UTSW 1 59867716 missense probably damaging 1.00
R4668:Bmpr2 UTSW 1 59867716 missense probably damaging 1.00
R4669:Bmpr2 UTSW 1 59867716 missense probably damaging 1.00
R4868:Bmpr2 UTSW 1 59870456 missense probably benign 0.03
R4922:Bmpr2 UTSW 1 59867424 missense probably benign
R5015:Bmpr2 UTSW 1 59851224 missense probably damaging 1.00
R5421:Bmpr2 UTSW 1 59870418 missense possibly damaging 0.96
R5808:Bmpr2 UTSW 1 59867401 missense probably benign 0.09
R6057:Bmpr2 UTSW 1 59842818 missense probably benign 0.00
R6228:Bmpr2 UTSW 1 59867436 missense probably benign 0.11
R6449:Bmpr2 UTSW 1 59867437 missense probably damaging 0.99
R6475:Bmpr2 UTSW 1 59868344 missense probably damaging 1.00
R6754:Bmpr2 UTSW 1 59870280 missense probably damaging 1.00
R7080:Bmpr2 UTSW 1 59867683 missense probably benign 0.00
R7410:Bmpr2 UTSW 1 59868493 missense probably benign
R7425:Bmpr2 UTSW 1 59867351 missense probably benign 0.12
R8027:Bmpr2 UTSW 1 59867803 missense not run
R8032:Bmpr2 UTSW 1 59867343 missense not run
Z1176:Bmpr2 UTSW 1 59847167 missense not run
Z1177:Bmpr2 UTSW 1 59847167 missense not run
Predicted Primers PCR Primer
(F):5'- AAAGCAGTGGGACTTTGGAATC -3'
(R):5'- GCATCTCAGATATAGTGGTCATGC -3'

Sequencing Primer
(F):5'- CAGTGGGACTTTGGAATCAGTGG -3'
(R):5'- CAGTACTTGGAGTGAGGCC -3'
Posted On2015-08-18