Incidental Mutation 'R4602:Tgtp2'
ID345730
Institutional Source Beutler Lab
Gene Symbol Tgtp2
Ensembl Gene ENSMUSG00000078921
Gene NameT cell specific GTPase 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4602 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location49057194-49064206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49058984 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 254 (T254A)
Ref Sequence ENSEMBL: ENSMUSP00000045025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046745] [ENSMUST00000056759] [ENSMUST00000102785] [ENSMUST00000179282]
Predicted Effect probably damaging
Transcript: ENSMUST00000046745
AA Change: T254A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045025
Gene: ENSMUSG00000078921
AA Change: T254A

DomainStartEndE-ValueType
Pfam:IIGP 22 395 2.9e-178 PFAM
Pfam:MMR_HSR1 58 217 5.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056759
SMART Domains Protein: ENSMUSP00000058544
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102785
SMART Domains Protein: ENSMUSP00000099846
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128411
Predicted Effect probably benign
Transcript: ENSMUST00000179282
SMART Domains Protein: ENSMUSP00000136647
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 1 276 3.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 3.8e-26 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
Ahnak A G 19: 9,010,825 K3158E possibly damaging Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Ankmy1 A T 1: 92,888,650 N247K probably benign Het
Atp1a1 A G 3: 101,586,943 V447A probably benign Het
Atp1a4 A C 1: 172,239,765 M600R probably damaging Het
Baat A G 4: 49,502,727 Y132H probably damaging Het
Ceacam15 A G 7: 16,671,981 V215A probably damaging Het
Celf2 G T 2: 6,586,020 N279K possibly damaging Het
Clec14a C T 12: 58,267,981 R285H probably benign Het
Ctnna1 T G 18: 35,179,827 I244R possibly damaging Het
D230025D16Rik C A 8: 105,246,888 N282K possibly damaging Het
Dcxr T A 11: 120,726,304 N105Y possibly damaging Het
Dnajc6 T C 4: 101,611,264 F166L probably damaging Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Faf1 A G 4: 109,727,428 D67G probably benign Het
Fancm G A 12: 65,124,944 R1786H probably benign Het
Fnbp1 A G 2: 31,036,540 probably null Het
Frem2 A G 3: 53,547,807 L2116S possibly damaging Het
Gbp5 A G 3: 142,503,785 E164G probably benign Het
Gm4922 A T 10: 18,784,259 Y238* probably null Het
Gm8257 A G 14: 44,656,317 Y62H probably damaging Het
Grin2b A G 6: 135,778,741 F525S probably damaging Het
Hfe2 T G 3: 96,527,553 S203A probably benign Het
Hsd17b3 C A 13: 64,063,170 probably null Het
Ighv1-23 T A 12: 114,764,559 Q81L probably benign Het
Inpp4b T C 8: 81,969,535 V366A probably damaging Het
Jak1 G T 4: 101,179,594 A283D possibly damaging Het
Kmt2d G T 15: 98,850,259 probably benign Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mettl17 T C 14: 51,888,789 V218A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nfat5 C T 8: 107,367,223 Q699* probably null Het
Olfr1193 G A 2: 88,677,896 V14I probably benign Het
Olfr1193 T G 2: 88,678,179 V101G probably benign Het
Olfr868 C A 9: 20,101,244 H162N probably benign Het
Osbpl7 C A 11: 97,056,269 S265R possibly damaging Het
Pcdh15 A G 10: 74,594,214 T1258A probably damaging Het
Pcdh20 A T 14: 88,468,430 L478Q probably damaging Het
Pde11a A G 2: 76,158,333 V488A probably benign Het
Phactr1 A T 13: 43,094,965 E463D probably benign Het
Samd9l A T 6: 3,373,935 Y1109N probably damaging Het
Samd9l GAA GAAA 6: 3,373,937 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Sgk2 G A 2: 162,994,754 probably null Het
Slco1a6 C A 6: 142,101,652 C404F probably benign Het
Spaca6 C T 17: 17,831,125 A21V probably damaging Het
Sphkap G T 1: 83,279,061 Y322* probably null Het
Sptlc3 G A 2: 139,636,680 V520I probably benign Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Syt9 A T 7: 107,436,387 K204* probably null Het
Taf3 A G 2: 9,952,657 V233A probably damaging Het
Tbccd1 T C 16: 22,818,535 probably null Het
Tdrd5 T A 1: 156,284,374 T479S probably benign Het
Tex10 T C 4: 48,452,946 D671G probably benign Het
Tmtc2 T C 10: 105,413,530 Y114C probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ubac1 A T 2: 25,998,977 I402N probably damaging Het
Zmat1 A T X: 134,972,945 S566T probably damaging Homo
Other mutations in Tgtp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02450:Tgtp2 APN 11 49059490 missense probably benign 0.35
Aha2016 UTSW 11 49059352 missense probably damaging 1.00
R1498:Tgtp2 UTSW 11 49059338 missense probably damaging 1.00
R1779:Tgtp2 UTSW 11 49058924 missense probably benign
R1958:Tgtp2 UTSW 11 49059092 missense probably damaging 1.00
R2402:Tgtp2 UTSW 11 49059130 missense probably benign 0.00
R2962:Tgtp2 UTSW 11 49059536 missense probably damaging 1.00
R4124:Tgtp2 UTSW 11 49059411 missense probably damaging 0.99
R4484:Tgtp2 UTSW 11 49059352 missense probably damaging 1.00
R4772:Tgtp2 UTSW 11 49058984 missense probably damaging 1.00
R4965:Tgtp2 UTSW 11 49059410 missense probably damaging 1.00
R5263:Tgtp2 UTSW 11 49059263 missense probably damaging 1.00
R5426:Tgtp2 UTSW 11 49059256 missense probably benign
R7128:Tgtp2 UTSW 11 49059308 missense possibly damaging 0.77
R7147:Tgtp2 UTSW 11 49059308 missense probably damaging 1.00
R7188:Tgtp2 UTSW 11 49059308 missense probably damaging 1.00
Z1177:Tgtp2 UTSW 11 49059351 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- AGTGAAGCATCATCCAGCCC -3'
(R):5'- TTGTCAGAACCAAGATAGACAGCG -3'

Sequencing Primer
(F):5'- CCCAAAGTAAGACCTGTAGAGATTG -3'
(R):5'- ACCAAGATAGACAGCGACTTAG -3'
Posted On2015-09-25