Incidental Mutation 'R0270:Postn'
ID35192
Institutional Source Beutler Lab
Gene Symbol Postn
Ensembl Gene ENSMUSG00000027750
Gene Nameperiostin, osteoblast specific factor
Synonymsperi, A630052E07Rik, OSF-2, Osf2, Periostin
MMRRC Submission 038496-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0270 (G1)
Quality Score86
Status Validated
Chromosome3
Chromosomal Location54361109-54391037 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 54384550 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 724 (T724N)
Ref Sequence ENSEMBL: ENSMUSP00000112735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073012] [ENSMUST00000081564] [ENSMUST00000107985] [ENSMUST00000117373]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073012
AA Change: T724N

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072773
Gene: ENSMUSG00000027750
AA Change: T724N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081564
AA Change: T751N

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080276
Gene: ENSMUSG00000027750
AA Change: T751N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
low complexity region 669 680 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107985
AA Change: T751N

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103619
Gene: ENSMUSG00000027750
AA Change: T751N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
low complexity region 669 680 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117373
AA Change: T724N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112735
Gene: ENSMUSG00000027750
AA Change: T724N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127452
Predicted Effect unknown
Transcript: ENSMUST00000143258
AA Change: T68N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154157
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.7%
  • 10x: 96.0%
  • 20x: 93.2%
Validation Efficiency 99% (113/114)
MGI Phenotype FUNCTION: This gene encodes a secreted extracellular matrix protein that functions in tissue development and regeneration, including wound healing and ventricular remodeling following myocardial infarction. The encoded protein binds to integrins to support adhesion and migration of epithelial cells. This protein plays a role in cancer stem cell maintenance and metastasis. Mice lacking this gene exhibit cardiac valve disease, and skeletal and dental defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice display abnormalities of the enamel, periodontal ligament, ameloblasts, and incisors. For one allele changing the hardness of the food alters the severity of the abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T A 1: 120,166,176 probably benign Het
4922502D21Rik A T 6: 129,325,608 L152* probably null Het
Abcf3 T A 16: 20,560,168 probably null Het
Acadm C T 3: 153,936,324 M190I possibly damaging Het
Adamtsl3 G A 7: 82,556,824 R739Q probably damaging Het
Ank1 T A 8: 23,088,925 probably benign Het
Ap3b1 T A 13: 94,404,118 probably benign Het
Arhgdib A G 6: 136,926,734 V31A probably damaging Het
Arid4a A G 12: 71,072,632 R342G probably damaging Het
Asic3 C T 5: 24,417,702 L517F probably benign Het
Atxn7l1 C T 12: 33,342,151 P242L possibly damaging Het
AY761185 T A 8: 20,944,600 E37D possibly damaging Het
Babam1 T A 8: 71,398,406 D104E probably damaging Het
Batf A T 12: 85,708,672 T100S probably benign Het
Blcap A T 2: 157,557,977 Y59* probably null Het
Cacnb3 G A 15: 98,642,559 A350T probably damaging Het
Cdk15 T A 1: 59,310,806 V319D probably damaging Het
Cenpf T C 1: 189,650,714 H2661R probably benign Het
Cenpq T C 17: 40,930,050 E106G probably damaging Het
Cfap43 A G 19: 47,797,203 probably benign Het
Cfb G A 17: 34,860,386 S778L possibly damaging Het
Clspn T A 4: 126,573,236 N631K probably damaging Het
Cntn2 T A 1: 132,521,724 T660S probably damaging Het
Cntrob T A 11: 69,311,341 H475L possibly damaging Het
Ddx46 T C 13: 55,674,104 I863T probably benign Het
Dnah11 G A 12: 118,041,013 T2191I probably damaging Het
Dock9 T C 14: 121,575,999 T1703A probably benign Het
Fam13c C T 10: 70,544,513 P424S probably benign Het
Fan1 T C 7: 64,348,871 N968D probably benign Het
Fbxl20 A T 11: 98,098,503 probably benign Het
Fkbp1b A T 12: 4,838,229 probably benign Het
G930045G22Rik T A 6: 50,847,059 noncoding transcript Het
Gm28042 C A 2: 120,041,592 R1008S probably benign Het
Gm6614 T A 6: 141,972,411 I580F possibly damaging Het
Gm8298 T A 3: 59,877,019 N304K probably benign Het
Gon4l G A 3: 88,858,400 S376N probably damaging Het
Gstt3 C A 10: 75,780,915 R15L probably damaging Het
Gtdc1 A T 2: 44,752,174 S73T possibly damaging Het
H2afy G A 13: 56,096,114 probably benign Het
Hhatl A G 9: 121,784,720 S419P probably benign Het
Hirip3 T G 7: 126,863,191 S46R probably damaging Het
Hsf2 A G 10: 57,502,639 T204A probably benign Het
Impg2 G A 16: 56,269,015 E1108K possibly damaging Het
Itgb2l G T 16: 96,422,930 probably benign Het
Itih5 A T 2: 10,251,264 N847I probably benign Het
Kif1a T C 1: 93,054,442 probably benign Het
Klhl1 T A 14: 96,518,344 probably benign Het
Ktn1 T A 14: 47,714,662 D963E probably benign Het
Lclat1 T A 17: 73,240,027 V313E probably benign Het
Lrrn4 T C 2: 132,870,719 S395G probably benign Het
Mbtps1 G A 8: 119,538,117 probably benign Het
Me1 A G 9: 86,596,204 probably benign Het
Mov10 C A 3: 104,795,405 C948F probably benign Het
Mterf1a G A 5: 3,890,990 Q293* probably null Het
Nfkb2 A T 19: 46,311,626 M838L possibly damaging Het
Nhlrc2 T A 19: 56,551,870 L97Q probably damaging Het
Nr6a1 A T 2: 38,739,020 Y331N possibly damaging Het
Nup214 C T 2: 32,034,814 A1785V probably damaging Het
Ogg1 C T 6: 113,329,256 T138I probably benign Het
Olfr1461 A G 19: 13,165,887 Y291C probably damaging Het
Olfr1489 A G 19: 13,633,684 Y191C probably damaging Het
Olfr202 A G 16: 59,283,753 V248A probably damaging Het
Olfr829 T A 9: 18,856,831 Y60N probably damaging Het
Plod2 G T 9: 92,584,521 R178L probably benign Het
Polr3b T A 10: 84,718,475 L1017Q probably benign Het
Ppm1l T G 3: 69,317,976 probably benign Het
Prpf8 T G 11: 75,505,249 L1983R probably damaging Het
Psma7 A G 2: 180,039,400 V59A probably benign Het
Qser1 T A 2: 104,788,961 Y502F probably benign Het
Rad50 T C 11: 53,668,025 D1129G probably damaging Het
Rasal1 C A 5: 120,674,729 P606Q probably damaging Het
Rgs6 A G 12: 83,133,689 Y438C probably damaging Het
Rnf180 A G 13: 105,252,266 C73R probably benign Het
Rnf216 T A 5: 143,080,241 I474F possibly damaging Het
Sdha A T 13: 74,332,247 L371Q probably damaging Het
Sdk1 T G 5: 142,084,566 L1162R possibly damaging Het
Sh3rf2 T C 18: 42,104,081 I223T probably damaging Het
Sirpb1a A G 3: 15,410,527 V316A probably damaging Het
Slc12a4 A T 8: 105,945,389 I897N probably benign Het
Slc35d1 A T 4: 103,190,838 V243E probably damaging Het
Slc4a11 T A 2: 130,690,932 K200N possibly damaging Het
Slc9a8 T A 2: 167,451,296 M188K probably damaging Het
Snrnp200 T C 2: 127,232,982 S1492P probably damaging Het
Sphk2 T C 7: 45,710,725 *618W probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tdpoz3 A G 3: 93,826,924 N302S probably benign Het
Tdrd6 T C 17: 43,624,308 M1950V probably benign Het
Tmem39a A G 16: 38,564,313 probably benign Het
Trip4 A T 9: 65,858,358 I353K probably damaging Het
Trip6 A T 5: 137,312,841 F204L probably benign Het
Trpm4 T A 7: 45,319,253 I419F possibly damaging Het
Ttn C A 2: 76,944,796 E1967D probably damaging Het
Uba2 C T 7: 34,150,856 V391M possibly damaging Het
Ubr4 T G 4: 139,479,435 probably benign Het
Upf1 G A 8: 70,335,645 probably benign Het
Vmn1r228 A C 17: 20,776,596 V220G possibly damaging Het
Vmn2r79 A G 7: 87,003,386 M429V probably benign Het
Vps36 C T 8: 22,210,456 T210I possibly damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Ybx1 C T 4: 119,281,591 G126D probably benign Het
Yipf5 C A 18: 40,206,407 probably benign Het
Zdhhc5 A C 2: 84,690,115 S573A probably benign Het
Zfp457 A T 13: 67,293,927 C99S probably damaging Het
Zfp52 T A 17: 21,561,302 C471S probably damaging Het
Zfp558 C T 9: 18,467,956 V71I probably damaging Het
Zfp651 A G 9: 121,767,575 T666A probably benign Het
Zfp655 A G 5: 145,244,457 Y375C probably damaging Het
Zfp882 A T 8: 71,914,615 T429S probably benign Het
Zmym2 T C 14: 56,949,684 probably null Het
Other mutations in Postn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Postn APN 3 54373728 missense probably damaging 1.00
IGL00567:Postn APN 3 54384523 missense probably benign
IGL00742:Postn APN 3 54372894 missense possibly damaging 0.81
IGL00971:Postn APN 3 54369276 missense possibly damaging 0.88
IGL01105:Postn APN 3 54362710 missense probably damaging 1.00
IGL01460:Postn APN 3 54375158 unclassified probably benign
IGL01609:Postn APN 3 54369228 missense probably damaging 0.99
IGL01878:Postn APN 3 54383480 splice site probably null
IGL01885:Postn APN 3 54376034 unclassified probably benign
IGL02040:Postn APN 3 54362689 missense probably benign
IGL02431:Postn APN 3 54375096 missense probably damaging 0.99
IGL02578:Postn APN 3 54377204 missense possibly damaging 0.93
IGL02943:Postn APN 3 54377608 critical splice donor site probably null
IGL03307:Postn APN 3 54375127 missense probably benign 0.32
sticklike UTSW 3 54372106 missense probably damaging 1.00
R0117:Postn UTSW 3 54383481 splice site probably benign
R0410:Postn UTSW 3 54385277 missense possibly damaging 0.93
R0548:Postn UTSW 3 54367576 nonsense probably null
R0734:Postn UTSW 3 54362715 missense probably damaging 1.00
R1648:Postn UTSW 3 54376101 missense probably damaging 1.00
R1796:Postn UTSW 3 54373756 missense probably damaging 1.00
R1823:Postn UTSW 3 54385287 critical splice donor site probably null
R1938:Postn UTSW 3 54377612 splice site probably null
R2311:Postn UTSW 3 54385223 missense probably damaging 0.98
R2566:Postn UTSW 3 54376953 missense probably damaging 0.97
R2938:Postn UTSW 3 54370310 missense probably damaging 1.00
R4105:Postn UTSW 3 54376041 missense probably damaging 1.00
R4394:Postn UTSW 3 54370955 missense probably damaging 1.00
R4620:Postn UTSW 3 54376993 missense probably damaging 1.00
R4628:Postn UTSW 3 54372157 missense probably damaging 1.00
R4697:Postn UTSW 3 54375071 missense probably damaging 1.00
R4709:Postn UTSW 3 54384610 intron probably benign
R4952:Postn UTSW 3 54390315 utr 3 prime probably benign
R5303:Postn UTSW 3 54377597 missense probably damaging 1.00
R5704:Postn UTSW 3 54372106 missense probably damaging 1.00
R5902:Postn UTSW 3 54372089 missense probably benign 0.03
R5914:Postn UTSW 3 54373800 nonsense probably null
R6032:Postn UTSW 3 54376716 missense possibly damaging 0.53
R6032:Postn UTSW 3 54376716 missense possibly damaging 0.53
R6101:Postn UTSW 3 54372220 splice site probably null
R6105:Postn UTSW 3 54372220 splice site probably null
R6334:Postn UTSW 3 54385282 missense probably benign
R7131:Postn UTSW 3 54362635 missense probably damaging 1.00
R7322:Postn UTSW 3 54370280 missense probably damaging 1.00
R7430:Postn UTSW 3 54370202 missense probably damaging 1.00
R7497:Postn UTSW 3 54362670 missense probably damaging 1.00
RF018:Postn UTSW 3 54384492 missense probably damaging 0.96
X0004:Postn UTSW 3 54362694 missense probably damaging 1.00
X0022:Postn UTSW 3 54370840 missense probably benign 0.03
Z1088:Postn UTSW 3 54375127 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- AACAATGGCTAGGGCTGTCTCTTAAAC -3'
(R):5'- GACTGTAGCATGAATAGAACCCCAAAGG -3'

Sequencing Primer
(F):5'- GGGCTGTCTCTTAAACAAACGTG -3'
(R):5'- TTCAGTAACTTGGGAAGCTGTAAAAG -3'
Posted On2013-05-09