Incidental Mutation 'R4196:Gm2396'
ID368374
Institutional Source Beutler Lab
Gene Symbol Gm2396
Ensembl Gene ENSMUSG00000099930
Gene Namepredicted gene 2396
Synonyms
MMRRC Submission 041027-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R4196 (G1)
Quality Score70
Status Validated
Chromosome9
Chromosomal Location88878994-88937342 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 88917662 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188232
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,263,556 probably benign Het
Acmsd T G 1: 127,749,194 L152R probably damaging Het
Ankle2 A G 5: 110,244,543 K472E possibly damaging Het
Aup1 T C 6: 83,055,230 V126A probably damaging Het
Baz1a T C 12: 54,911,415 Y1014C probably damaging Het
Bcl9 A T 3: 97,216,368 probably benign Het
Cnot2 A T 10: 116,501,304 N221K possibly damaging Het
Col19a1 G A 1: 24,534,052 S213L unknown Het
Eif4enif1 T C 11: 3,243,186 V675A possibly damaging Het
Elp3 A G 14: 65,548,002 L450P probably damaging Het
Erbb4 C T 1: 68,343,855 D328N possibly damaging Het
Fbll1 T A 11: 35,797,872 H188L possibly damaging Het
Frem2 A G 3: 53,539,268 F2360L possibly damaging Het
Gulo G T 14: 65,988,253 P375T possibly damaging Het
Hspd1 T C 1: 55,086,909 M11V probably benign Het
Ikbkap A T 4: 56,755,353 N1295K probably damaging Het
Itgav A G 2: 83,768,327 T243A probably benign Het
Lipg C T 18: 74,945,831 R450H probably damaging Het
Lrp3 T A 7: 35,203,410 S504C probably damaging Het
Mrps9 T G 1: 42,901,094 probably benign Het
Nlgn1 A G 3: 25,434,392 V564A probably damaging Het
Ntf3 T C 6: 126,102,175 T110A probably benign Het
Pkd1l1 T A 11: 8,909,929 I560F probably damaging Het
Prepl T C 17: 85,081,154 T174A probably benign Het
Ptprg A T 14: 12,122,002 T289S possibly damaging Het
Rab11fip2 T C 19: 59,935,781 T222A probably damaging Het
Rhbdd3 G T 11: 5,099,460 probably benign Het
Sept4 C A 11: 87,588,772 D239E probably damaging Het
Shprh A G 10: 11,207,860 probably benign Het
Slc3a1 T A 17: 85,060,878 W525R probably damaging Het
Trim75 A G 8: 64,982,764 S345P probably damaging Het
Usp5 C T 6: 124,824,938 E72K possibly damaging Het
Vmn1r225 T A 17: 20,502,975 M226K probably benign Het
Wnk4 T A 11: 101,269,631 V697E probably damaging Het
Zbtb9 C T 17: 26,973,879 T86I probably benign Het
Other mutations in Gm2396
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4195:Gm2396 UTSW 9 88917662 intron noncoding transcript
R4896:Gm2396 UTSW 9 88931228 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TCCATTGGGTCTGCTTATCG -3'
(R):5'- CATCTGCAGTGCCTAGGTCTTC -3'

Sequencing Primer
(F):5'- GATCCTATTTATTCCAACCCTACAC -3'
(R):5'- TTTTAAGCCAGCCTAGGG -3'
Posted On2016-02-02