Incidental Mutation 'R4864:Eef1d'
ID374779
Institutional Source Beutler Lab
Gene Symbol Eef1d
Ensembl Gene ENSMUSG00000055762
Gene Nameeukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
Synonyms
MMRRC Submission 042474-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R4864 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location75894205-75909556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75903406 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 135 (S135P)
Ref Sequence ENSEMBL: ENSMUSP00000123388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023235] [ENSMUST00000089680] [ENSMUST00000089681] [ENSMUST00000109972] [ENSMUST00000109975] [ENSMUST00000116440] [ENSMUST00000123712] [ENSMUST00000127550] [ENSMUST00000137426] [ENSMUST00000141268] [ENSMUST00000141475] [ENSMUST00000144614] [ENSMUST00000145764] [ENSMUST00000151066] [ENSMUST00000154584]
Predicted Effect probably benign
Transcript: ENSMUST00000023235
SMART Domains Protein: ENSMUSP00000023235
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 62 75 N/A INTRINSIC
coiled coil region 82 120 N/A INTRINSIC
EF-1_beta_acid 159 186 2.53e-4 SMART
Pfam:EF1_GNE 195 245 3.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000055220
Predicted Effect probably benign
Transcript: ENSMUST00000089680
SMART Domains Protein: ENSMUSP00000087109
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 54 70 N/A INTRINSIC
coiled coil region 77 115 N/A INTRINSIC
EF-1_beta_acid 154 181 2.53e-4 SMART
EF1_GNE 190 276 4.87e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000089681
AA Change: S135P

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000087110
Gene: ENSMUSG00000055762
AA Change: S135P

DomainStartEndE-ValueType
low complexity region 32 52 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
internal_repeat_2 108 136 2.92e-5 PROSPERO
low complexity region 137 156 N/A INTRINSIC
internal_repeat_2 231 259 2.92e-5 PROSPERO
internal_repeat_1 244 263 2.02e-6 PROSPERO
internal_repeat_1 389 408 2.02e-6 PROSPERO
low complexity region 441 454 N/A INTRINSIC
coiled coil region 461 499 N/A INTRINSIC
EF-1_beta_acid 538 565 2.53e-4 SMART
EF1_GNE 574 660 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109972
SMART Domains Protein: ENSMUSP00000105599
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
coiled coil region 58 96 N/A INTRINSIC
EF-1_beta_acid 135 162 2.53e-4 SMART
EF1_GNE 171 257 4.87e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109975
AA Change: S135P

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105602
Gene: ENSMUSG00000055762
AA Change: S135P

DomainStartEndE-ValueType
low complexity region 32 52 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
internal_repeat_2 108 136 2.92e-5 PROSPERO
low complexity region 137 156 N/A INTRINSIC
internal_repeat_2 231 259 2.92e-5 PROSPERO
internal_repeat_1 244 263 2.02e-6 PROSPERO
internal_repeat_1 389 408 2.02e-6 PROSPERO
low complexity region 441 454 N/A INTRINSIC
coiled coil region 461 499 N/A INTRINSIC
EF-1_beta_acid 538 565 2.53e-4 SMART
EF1_GNE 574 660 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116440
SMART Domains Protein: ENSMUSP00000112141
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
coiled coil region 58 96 N/A INTRINSIC
EF-1_beta_acid 135 162 2.53e-4 SMART
EF1_GNE 171 257 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123712
SMART Domains Protein: ENSMUSP00000122155
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
coiled coil region 58 96 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000127550
AA Change: S135P

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120735
Gene: ENSMUSG00000055762
AA Change: S135P

DomainStartEndE-ValueType
low complexity region 32 52 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
low complexity region 137 156 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129800
Predicted Effect possibly damaging
Transcript: ENSMUST00000137426
AA Change: S51P

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114753
Gene: ENSMUSG00000055762
AA Change: S51P

DomainStartEndE-ValueType
low complexity region 53 72 N/A INTRINSIC
internal_repeat_1 160 179 9.48e-6 PROSPERO
internal_repeat_1 305 324 9.48e-6 PROSPERO
low complexity region 330 346 N/A INTRINSIC
coiled coil region 353 391 N/A INTRINSIC
EF-1_beta_acid 430 457 2.53e-4 SMART
EF1_GNE 466 552 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141268
SMART Domains Protein: ENSMUSP00000115553
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 78 94 N/A INTRINSIC
coiled coil region 101 139 N/A INTRINSIC
EF-1_beta_acid 178 205 2.53e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000141475
AA Change: S135P

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123388
Gene: ENSMUSG00000055762
AA Change: S135P

DomainStartEndE-ValueType
low complexity region 32 52 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
internal_repeat_1 122 136 7.17e-5 PROSPERO
low complexity region 137 156 N/A INTRINSIC
internal_repeat_1 174 188 7.17e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000144614
SMART Domains Protein: ENSMUSP00000123005
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 62 75 N/A INTRINSIC
coiled coil region 82 120 N/A INTRINSIC
EF-1_beta_acid 159 186 2.53e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145764
SMART Domains Protein: ENSMUSP00000117782
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 32 52 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151066
SMART Domains Protein: ENSMUSP00000118889
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
EF-1_beta_acid 68 95 2.53e-4 SMART
EF1_GNE 104 190 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154584
SMART Domains Protein: ENSMUSP00000116360
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 62 75 N/A INTRINSIC
coiled coil region 82 120 N/A INTRINSIC
EF-1_beta_acid 159 186 1.2e-8 SMART
EF1_GNE 195 280 4.9e-41 SMART
Meta Mutation Damage Score 0.0739 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This subunit, delta, functions as guanine nucleotide exchange factor. It is reported that following HIV-1 infection, this subunit interacts with HIV-1 Tat. This interaction results in repression of translation of host cell proteins and enhanced translation of viral proteins. Several alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. Related pseudogenes have been defined on chromosomes 1, 6, 7, 9, 11, 13, 17, 19.[provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
Acp6 T C 3: 97,159,367 probably null Het
Adora3 T A 3: 105,907,815 Y148N probably damaging Het
Ahnak2 G A 12: 112,773,606 S538L probably damaging Het
Aox3 T G 1: 58,176,487 V1026G probably damaging Het
Ap3d1 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 10: 80,712,778 probably null Het
Arhgef37 G A 18: 61,494,925 A649V probably benign Het
Atp5a1 G A 18: 77,781,315 R413H possibly damaging Het
Bace1 A T 9: 45,854,811 I179F probably damaging Het
Brinp1 A G 4: 68,798,886 F242L probably damaging Het
Brk1 T C 6: 113,615,844 Y63H possibly damaging Het
Ccdc74a A G 16: 17,648,872 T148A probably benign Het
Cenpc1 T A 5: 86,045,321 L236F probably damaging Het
Col13a1 C T 10: 61,862,660 E541K unknown Het
Copg1 T A 6: 87,889,696 C44S probably damaging Het
D130043K22Rik A G 13: 24,863,612 E380G probably damaging Het
Dchs1 T C 7: 105,755,253 D2694G probably damaging Het
Dgkd A T 1: 87,916,838 N242I possibly damaging Het
Dnah2 C T 11: 69,422,590 V4248I probably damaging Het
Dpy19l3 T A 7: 35,712,182 K376* probably null Het
Epc2 T A 2: 49,537,165 S574T probably benign Het
Eps15 G A 4: 109,366,530 probably benign Het
Eps8 T C 6: 137,478,969 probably benign Het
Exoc5 A T 14: 49,052,382 V13E probably benign Het
Fbn1 A T 2: 125,372,397 C765S possibly damaging Het
Fbxo5 A T 10: 5,802,392 C74S probably benign Het
Fbxw9 T C 8: 85,065,901 S322P probably damaging Het
Fmo5 T A 3: 97,645,879 I381N probably damaging Het
Fmo6 T C 1: 162,924,395 D175G probably benign Het
Gm11127 T A 17: 36,058,361 probably benign Het
Gm340 G T 19: 41,585,364 A853S probably benign Het
Gm7361 A G 5: 26,262,010 probably null Het
Gm9961 G A 16: 11,903,035 probably benign Het
Golga7b T A 19: 42,266,966 probably null Het
Gorab T C 1: 163,386,398 E321G probably benign Het
Gpx1 T A 9: 108,339,395 V28E probably benign Het
Hist2h3c1 T C 3: 96,247,259 I125T probably damaging Het
Hk1 T C 10: 62,342,539 S8G probably benign Het
Iqsec1 C T 6: 90,664,056 R1026H probably damaging Het
Kdm4b A T 17: 56,353,091 Y86F probably benign Het
Kprp C T 3: 92,824,522 R407Q unknown Het
Lamb1 C T 12: 31,321,006 T1400M probably benign Het
Lrriq3 T A 3: 155,187,810 Y383N possibly damaging Het
Map3k21 T C 8: 125,927,555 I371T probably benign Het
Mllt1 A T 17: 56,905,819 F105I probably damaging Het
Nfatc2 A G 2: 168,536,392 M451T probably damaging Het
Nfkbiz A C 16: 55,818,424 N224K probably damaging Het
Nlrp4d A G 7: 10,381,161 V531A noncoding transcript Het
Noc3l A G 19: 38,789,637 Y778H probably benign Het
Nup98 C A 7: 102,153,196 A734S possibly damaging Het
Olfr1016 A G 2: 85,799,689 Y194H probably damaging Het
Olfr700 T C 7: 106,805,964 Y166C probably damaging Het
Olfr730 T A 14: 50,186,582 I212F probably damaging Het
Olfr824 T A 10: 130,126,887 R57* probably null Het
Pate4 A T 9: 35,608,239 C52S probably damaging Het
Pecr C A 1: 72,277,331 A72S probably benign Het
Pomt1 A G 2: 32,251,992 N578S probably benign Het
Ppm1a T C 12: 72,783,964 S88P probably benign Het
Ppm1l T A 3: 69,542,511 probably benign Het
Prdm13 A G 4: 21,685,543 S86P unknown Het
Prph2 T C 17: 46,910,922 S76P probably benign Het
Sarnp G A 10: 128,833,343 R23H probably damaging Het
Sept1 T C 7: 127,216,892 probably benign Het
Serpini1 T C 3: 75,613,174 I26T probably benign Het
Setdb2 A G 14: 59,409,266 I616T probably benign Het
Slc2a10 T C 2: 165,514,621 F67S probably benign Het
Slc38a6 T A 12: 73,343,650 probably null Het
Smg6 T C 11: 74,930,162 S420P possibly damaging Het
Srp72 T A 5: 76,984,162 H229Q probably benign Het
Ston2 A G 12: 91,648,674 V320A possibly damaging Het
Stx3 A T 19: 11,777,151 I269N possibly damaging Het
Tdg-ps A G 15: 82,516,642 noncoding transcript Het
Tecpr1 T A 5: 144,214,117 N291I probably benign Het
Tmem177 A G 1: 119,910,823 V42A probably benign Het
Trim26 T A 17: 36,857,994 probably benign Het
Ttc17 A G 2: 94,366,635 S456P probably benign Het
Tubgcp6 T C 15: 89,103,818 Y984C probably benign Het
Unc5cl A G 17: 48,459,844 E82G possibly damaging Het
Uncx T C 5: 139,544,120 S43P probably damaging Het
Vmn1r1 A G 1: 182,157,767 V111A probably benign Het
Vmn1r168 A G 7: 23,541,482 I255V probably damaging Het
Vwce A G 19: 10,650,636 T487A probably benign Het
Xaf1 A G 11: 72,306,856 probably benign Het
Zfp27 G T 7: 29,894,836 P568Q probably damaging Het
Zfp382 A T 7: 30,133,460 I179F possibly damaging Het
Other mutations in Eef1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02066:Eef1d APN 15 75896855 missense probably benign 0.10
IGL02265:Eef1d APN 15 75903434 missense probably benign 0.00
IGL02609:Eef1d APN 15 75896313 missense probably null 1.00
IGL02671:Eef1d APN 15 75895805 missense probably damaging 1.00
IGL02728:Eef1d APN 15 75903096 missense probably damaging 1.00
PIT4131001:Eef1d UTSW 15 75903732 missense probably benign 0.01
R0034:Eef1d UTSW 15 75902959 missense probably benign
R0523:Eef1d UTSW 15 75903156 missense probably benign
R0831:Eef1d UTSW 15 75896806 unclassified probably benign
R1164:Eef1d UTSW 15 75902677 critical splice donor site probably null
R1467:Eef1d UTSW 15 75895921 missense probably damaging 1.00
R1467:Eef1d UTSW 15 75895921 missense probably damaging 1.00
R1594:Eef1d UTSW 15 75896346 missense probably damaging 1.00
R1796:Eef1d UTSW 15 75901175 missense probably damaging 1.00
R2039:Eef1d UTSW 15 75895769 missense probably damaging 1.00
R2093:Eef1d UTSW 15 75902701 missense probably benign 0.00
R2119:Eef1d UTSW 15 75903213 missense probably benign 0.43
R2372:Eef1d UTSW 15 75896317 missense probably damaging 1.00
R4401:Eef1d UTSW 15 75902920 missense probably benign
R4403:Eef1d UTSW 15 75902920 missense probably benign
R4425:Eef1d UTSW 15 75902799 missense possibly damaging 0.92
R4614:Eef1d UTSW 15 75903576 missense probably benign 0.00
R4791:Eef1d UTSW 15 75903682 missense possibly damaging 0.85
R5376:Eef1d UTSW 15 75903189 missense probably benign 0.25
R5377:Eef1d UTSW 15 75903189 missense probably benign 0.25
R5415:Eef1d UTSW 15 75903181 missense probably benign 0.00
R6966:Eef1d UTSW 15 75903709 missense probably benign 0.06
R7640:Eef1d UTSW 15 75902707 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAAGGACTGAGACCACTC -3'
(R):5'- ACGAAGTGCCAGCTGTGAAC -3'

Sequencing Primer
(F):5'- GGACTGAGACCACTCCACAAAAG -3'
(R):5'- CCAGCCAGGAGGACACAG -3'
Posted On2016-03-17