Incidental Mutation 'R4864:Lamb1'
ID374769
Institutional Source Beutler Lab
Gene Symbol Lamb1
Ensembl Gene ENSMUSG00000002900
Gene Namelaminin B1
SynonymsC80098, C81607, Lamb1-1, Lamb-1, D130003D08Rik
MMRRC Submission 042474-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4864 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location31265234-31329644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31321006 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1400 (T1400M)
Ref Sequence ENSEMBL: ENSMUSP00000002979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002979] [ENSMUST00000169088]
Predicted Effect probably benign
Transcript: ENSMUST00000002979
AA Change: T1400M

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000002979
Gene: ENSMUSG00000002900
AA Change: T1400M

DomainStartEndE-ValueType
low complexity region 32 45 N/A INTRINSIC
LamNT 77 317 3.24e-96 SMART
EGF_Lam 319 380 1.34e-6 SMART
EGF_Lam 383 443 1.33e-10 SMART
EGF_Lam 446 503 2.89e-11 SMART
EGF_Lam 506 555 2.89e-11 SMART
EGF_Lam 558 602 3.4e-8 SMART
EGF_Lam 821 866 4.99e-15 SMART
EGF_Lam 869 912 2.38e-12 SMART
EGF_Lam 915 962 2.4e-8 SMART
EGF_Lam 965 1021 1.41e-5 SMART
EGF_Lam 1024 1073 4.81e-8 SMART
EGF_Lam 1076 1129 3.81e-11 SMART
EGF_Lam 1132 1177 5.61e-9 SMART
EGF_Lam 1180 1224 2.89e-11 SMART
coiled coil region 1329 1360 N/A INTRINSIC
low complexity region 1468 1480 N/A INTRINSIC
coiled coil region 1497 1551 N/A INTRINSIC
coiled coil region 1600 1826 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169088
AA Change: T1352M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000132778
Gene: ENSMUSG00000002900
AA Change: T1352M

DomainStartEndE-ValueType
LamNT 29 269 3.24e-96 SMART
EGF_Lam 271 332 1.34e-6 SMART
EGF_Lam 335 395 1.33e-10 SMART
EGF_Lam 398 455 2.89e-11 SMART
EGF_Lam 458 507 2.89e-11 SMART
EGF_Lam 510 554 3.4e-8 SMART
EGF_Lam 773 818 4.99e-15 SMART
EGF_Lam 821 864 2.38e-12 SMART
EGF_Lam 867 914 2.4e-8 SMART
EGF_Lam 917 973 1.41e-5 SMART
EGF_Lam 976 1025 4.81e-8 SMART
EGF_Lam 1028 1081 3.81e-11 SMART
EGF_Lam 1084 1129 5.61e-9 SMART
EGF_Lam 1132 1176 2.89e-11 SMART
coiled coil region 1281 1312 N/A INTRINSIC
low complexity region 1420 1432 N/A INTRINSIC
coiled coil region 1449 1503 N/A INTRINSIC
coiled coil region 1552 1778 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172134
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 1. The beta 1 chain has 7 structurally distinct domains which it shares with other beta chain isomers. The C-terminal helical region containing domains I and II are separated by domain alpha, domains III and V contain several EGF-like repeats, and domains IV and VI have a globular conformation. Laminin, beta 1 is expressed in most tissues that produce basement membranes, and is one of the 3 chains constituting laminin 1, the first laminin isolated from Engelbreth-Holm-Swarm (EHS) tumor. A sequence in the beta 1 chain that is involved in cell attachment, chemotaxis, and binding to the laminin receptor was identified and shown to have the capacity to inhibit metastasis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a gene trapped allele lack basement membranes and fail to survive past E5.5. Mice heterozygous for a spontaneous mutation exhibit dystonis with impaired neuron firing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
Acp6 T C 3: 97,159,367 probably null Het
Adora3 T A 3: 105,907,815 Y148N probably damaging Het
Ahnak2 G A 12: 112,773,606 S538L probably damaging Het
Aox3 T G 1: 58,176,487 V1026G probably damaging Het
Ap3d1 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 10: 80,712,778 probably null Het
Arhgef37 G A 18: 61,494,925 A649V probably benign Het
Atp5a1 G A 18: 77,781,315 R413H possibly damaging Het
Bace1 A T 9: 45,854,811 I179F probably damaging Het
Brinp1 A G 4: 68,798,886 F242L probably damaging Het
Brk1 T C 6: 113,615,844 Y63H possibly damaging Het
Ccdc74a A G 16: 17,648,872 T148A probably benign Het
Cenpc1 T A 5: 86,045,321 L236F probably damaging Het
Col13a1 C T 10: 61,862,660 E541K unknown Het
Copg1 T A 6: 87,889,696 C44S probably damaging Het
D130043K22Rik A G 13: 24,863,612 E380G probably damaging Het
Dchs1 T C 7: 105,755,253 D2694G probably damaging Het
Dgkd A T 1: 87,916,838 N242I possibly damaging Het
Dnah2 C T 11: 69,422,590 V4248I probably damaging Het
Dpy19l3 T A 7: 35,712,182 K376* probably null Het
Eef1d A G 15: 75,903,406 S135P possibly damaging Het
Epc2 T A 2: 49,537,165 S574T probably benign Het
Eps15 G A 4: 109,366,530 probably benign Het
Eps8 T C 6: 137,478,969 probably benign Het
Exoc5 A T 14: 49,052,382 V13E probably benign Het
Fbn1 A T 2: 125,372,397 C765S possibly damaging Het
Fbxo5 A T 10: 5,802,392 C74S probably benign Het
Fbxw9 T C 8: 85,065,901 S322P probably damaging Het
Fmo5 T A 3: 97,645,879 I381N probably damaging Het
Fmo6 T C 1: 162,924,395 D175G probably benign Het
Gm11127 T A 17: 36,058,361 probably benign Het
Gm340 G T 19: 41,585,364 A853S probably benign Het
Gm7361 A G 5: 26,262,010 probably null Het
Gm9961 G A 16: 11,903,035 probably benign Het
Golga7b T A 19: 42,266,966 probably null Het
Gorab T C 1: 163,386,398 E321G probably benign Het
Gpx1 T A 9: 108,339,395 V28E probably benign Het
Hist2h3c1 T C 3: 96,247,259 I125T probably damaging Het
Hk1 T C 10: 62,342,539 S8G probably benign Het
Iqsec1 C T 6: 90,664,056 R1026H probably damaging Het
Kdm4b A T 17: 56,353,091 Y86F probably benign Het
Kprp C T 3: 92,824,522 R407Q unknown Het
Lrriq3 T A 3: 155,187,810 Y383N possibly damaging Het
Map3k21 T C 8: 125,927,555 I371T probably benign Het
Mllt1 A T 17: 56,905,819 F105I probably damaging Het
Nfatc2 A G 2: 168,536,392 M451T probably damaging Het
Nfkbiz A C 16: 55,818,424 N224K probably damaging Het
Nlrp4d A G 7: 10,381,161 V531A noncoding transcript Het
Noc3l A G 19: 38,789,637 Y778H probably benign Het
Nup98 C A 7: 102,153,196 A734S possibly damaging Het
Olfr1016 A G 2: 85,799,689 Y194H probably damaging Het
Olfr700 T C 7: 106,805,964 Y166C probably damaging Het
Olfr730 T A 14: 50,186,582 I212F probably damaging Het
Olfr824 T A 10: 130,126,887 R57* probably null Het
Pate4 A T 9: 35,608,239 C52S probably damaging Het
Pecr C A 1: 72,277,331 A72S probably benign Het
Pomt1 A G 2: 32,251,992 N578S probably benign Het
Ppm1a T C 12: 72,783,964 S88P probably benign Het
Ppm1l T A 3: 69,542,511 probably benign Het
Prdm13 A G 4: 21,685,543 S86P unknown Het
Prph2 T C 17: 46,910,922 S76P probably benign Het
Sarnp G A 10: 128,833,343 R23H probably damaging Het
Sept1 T C 7: 127,216,892 probably benign Het
Serpini1 T C 3: 75,613,174 I26T probably benign Het
Setdb2 A G 14: 59,409,266 I616T probably benign Het
Slc2a10 T C 2: 165,514,621 F67S probably benign Het
Slc38a6 T A 12: 73,343,650 probably null Het
Smg6 T C 11: 74,930,162 S420P possibly damaging Het
Srp72 T A 5: 76,984,162 H229Q probably benign Het
Ston2 A G 12: 91,648,674 V320A possibly damaging Het
Stx3 A T 19: 11,777,151 I269N possibly damaging Het
Tdg-ps A G 15: 82,516,642 noncoding transcript Het
Tecpr1 T A 5: 144,214,117 N291I probably benign Het
Tmem177 A G 1: 119,910,823 V42A probably benign Het
Trim26 T A 17: 36,857,994 probably benign Het
Ttc17 A G 2: 94,366,635 S456P probably benign Het
Tubgcp6 T C 15: 89,103,818 Y984C probably benign Het
Unc5cl A G 17: 48,459,844 E82G possibly damaging Het
Uncx T C 5: 139,544,120 S43P probably damaging Het
Vmn1r1 A G 1: 182,157,767 V111A probably benign Het
Vmn1r168 A G 7: 23,541,482 I255V probably damaging Het
Vwce A G 19: 10,650,636 T487A probably benign Het
Xaf1 A G 11: 72,306,856 probably benign Het
Zfp27 G T 7: 29,894,836 P568Q probably damaging Het
Zfp382 A T 7: 30,133,460 I179F possibly damaging Het
Other mutations in Lamb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Lamb1 APN 12 31298826 missense possibly damaging 0.74
IGL00939:Lamb1 APN 12 31302927 missense probably damaging 1.00
IGL01017:Lamb1 APN 12 31301064 missense possibly damaging 0.89
IGL01384:Lamb1 APN 12 31320931 missense probably benign 0.09
IGL01470:Lamb1 APN 12 31300262 missense possibly damaging 0.55
IGL01554:Lamb1 APN 12 31306977 missense probably damaging 1.00
IGL02207:Lamb1 APN 12 31329435 missense probably damaging 1.00
IGL02271:Lamb1 APN 12 31300251 missense probably damaging 1.00
IGL02272:Lamb1 APN 12 31305769 missense probably benign 0.00
IGL02365:Lamb1 APN 12 31318345 missense probably damaging 1.00
IGL02471:Lamb1 APN 12 31320908 missense probably damaging 1.00
IGL02704:Lamb1 APN 12 31318467 missense probably benign 0.05
IGL03132:Lamb1 APN 12 31300334 splice site probably null
IGL03161:Lamb1 APN 12 31326256 missense probably benign 0.41
IGL03169:Lamb1 APN 12 31323646 missense probably damaging 1.00
Crush UTSW 12 31287424 missense probably damaging 1.00
deflationary UTSW 12 31321075 missense probably null 0.63
E0374:Lamb1 UTSW 12 31287930 missense probably damaging 1.00
P0043:Lamb1 UTSW 12 31278621 missense probably damaging 1.00
R0031:Lamb1 UTSW 12 31301156 missense probably benign 0.04
R0047:Lamb1 UTSW 12 31278601 missense possibly damaging 0.51
R0047:Lamb1 UTSW 12 31278601 missense possibly damaging 0.51
R0285:Lamb1 UTSW 12 31326645 nonsense probably null
R0456:Lamb1 UTSW 12 31304730 missense probably damaging 1.00
R0477:Lamb1 UTSW 12 31326269 missense possibly damaging 0.47
R0480:Lamb1 UTSW 12 31282721 missense possibly damaging 0.79
R0544:Lamb1 UTSW 12 31282695 missense probably damaging 1.00
R0565:Lamb1 UTSW 12 31298915 missense probably benign 0.02
R1500:Lamb1 UTSW 12 31298949 missense possibly damaging 0.82
R1624:Lamb1 UTSW 12 31278652 critical splice donor site probably null
R1772:Lamb1 UTSW 12 31278525 missense probably damaging 1.00
R1836:Lamb1 UTSW 12 31301094 missense probably benign 0.00
R1853:Lamb1 UTSW 12 31318272 missense probably damaging 1.00
R1854:Lamb1 UTSW 12 31318272 missense probably damaging 1.00
R1903:Lamb1 UTSW 12 31329210 missense probably damaging 1.00
R2091:Lamb1 UTSW 12 31287429 missense probably damaging 0.98
R2186:Lamb1 UTSW 12 31318467 nonsense probably null
R2268:Lamb1 UTSW 12 31327645 missense probably damaging 1.00
R2567:Lamb1 UTSW 12 31269055 critical splice acceptor site probably null
R2698:Lamb1 UTSW 12 31298883 missense probably benign 0.10
R3121:Lamb1 UTSW 12 31287529 missense probably damaging 1.00
R3405:Lamb1 UTSW 12 31287529 missense probably damaging 1.00
R3406:Lamb1 UTSW 12 31287529 missense probably damaging 1.00
R3608:Lamb1 UTSW 12 31287910 missense probably damaging 1.00
R3725:Lamb1 UTSW 12 31321075 missense probably null 0.63
R3726:Lamb1 UTSW 12 31321075 missense probably null 0.63
R3949:Lamb1 UTSW 12 31282649 missense probably damaging 1.00
R4308:Lamb1 UTSW 12 31329255 missense probably damaging 1.00
R4600:Lamb1 UTSW 12 31323529 missense probably benign 0.00
R4604:Lamb1 UTSW 12 31278776 missense probably damaging 1.00
R4701:Lamb1 UTSW 12 31266848 nonsense probably null
R4710:Lamb1 UTSW 12 31282583 missense probably benign 0.02
R4767:Lamb1 UTSW 12 31308011 missense probably damaging 1.00
R4809:Lamb1 UTSW 12 31278526 missense probably damaging 1.00
R4828:Lamb1 UTSW 12 31298930 missense probably benign
R4842:Lamb1 UTSW 12 31287433 missense probably damaging 1.00
R4909:Lamb1 UTSW 12 31288281 missense probably damaging 1.00
R4989:Lamb1 UTSW 12 31326678 missense probably damaging 1.00
R5444:Lamb1 UTSW 12 31298909 missense possibly damaging 0.47
R5736:Lamb1 UTSW 12 31302665 nonsense probably null
R5766:Lamb1 UTSW 12 31299931 missense probably damaging 1.00
R5825:Lamb1 UTSW 12 31318614 missense probably benign
R5840:Lamb1 UTSW 12 31266756 missense probably damaging 1.00
R5867:Lamb1 UTSW 12 31298955 missense possibly damaging 0.82
R5887:Lamb1 UTSW 12 31266864 nonsense probably null
R5984:Lamb1 UTSW 12 31327774 missense possibly damaging 0.76
R6313:Lamb1 UTSW 12 31269147 missense probably damaging 1.00
R6359:Lamb1 UTSW 12 31282716 missense probably damaging 0.97
R6505:Lamb1 UTSW 12 31323462 missense possibly damaging 0.63
R7127:Lamb1 UTSW 12 31324315 missense probably damaging 1.00
R7202:Lamb1 UTSW 12 31324315 missense probably damaging 1.00
R7271:Lamb1 UTSW 12 31287424 missense probably damaging 1.00
R7290:Lamb1 UTSW 12 31265596 missense probably benign 0.04
R7486:Lamb1 UTSW 12 31287442 missense probably benign 0.00
R7496:Lamb1 UTSW 12 31300021 missense probably benign 0.31
R7591:Lamb1 UTSW 12 31326648 missense probably damaging 1.00
R7722:Lamb1 UTSW 12 31323571 missense probably damaging 0.99
X0054:Lamb1 UTSW 12 31287434 missense probably damaging 1.00
X0064:Lamb1 UTSW 12 31303042 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- AAAATGGGCACTGTTTGGGG -3'
(R):5'- GAGTCACCCCTACAGGATTACG -3'

Sequencing Primer
(F):5'- CACTGTTTGGGGAGGACC -3'
(R):5'- GTCACCCCTACAGGATTACGAACAG -3'
Posted On2016-03-17