Incidental Mutation 'R4964:Map4k1'
ID383786
Institutional Source Beutler Lab
Gene Symbol Map4k1
Ensembl Gene ENSMUSG00000037337
Gene Namemitogen-activated protein kinase kinase kinase kinase 1
SynonymsHpk1
MMRRC Submission 042561-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4964 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location28982050-29003279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28983002 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 16 (H16L)
Ref Sequence ENSEMBL: ENSMUSP00000147189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066070] [ENSMUST00000085835] [ENSMUST00000207185] [ENSMUST00000207683] [ENSMUST00000208227] [ENSMUST00000208616] [ENSMUST00000208707]
Predicted Effect probably benign
Transcript: ENSMUST00000066070
SMART Domains Protein: ENSMUSP00000066038
Gene: ENSMUSG00000053565

DomainStartEndE-ValueType
Pfam:CSN8_PSD8_EIF3K 61 200 1.2e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085835
AA Change: H16L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000082995
Gene: ENSMUSG00000037337
AA Change: H16L

DomainStartEndE-ValueType
S_TKc 17 274 3.58e-84 SMART
low complexity region 301 318 N/A INTRINSIC
low complexity region 373 383 N/A INTRINSIC
low complexity region 385 416 N/A INTRINSIC
low complexity region 426 446 N/A INTRINSIC
CNH 506 813 4.93e-106 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207185
AA Change: H16L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000207683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207762
Predicted Effect probably benign
Transcript: ENSMUST00000208227
Predicted Effect probably benign
Transcript: ENSMUST00000208616
Predicted Effect probably benign
Transcript: ENSMUST00000208707
Meta Mutation Damage Score 0.0923 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 98% (100/102)
MGI Phenotype PHENOTYPE: Homozygous null mice have increased responses of B and T cells. Dendritic cells are also hyperresponsive to stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,474,221 probably benign Het
9030619P08Rik T A 15: 75,431,418 noncoding transcript Het
9030624J02Rik T C 7: 118,780,268 I426T possibly damaging Het
A430033K04Rik G T 5: 138,646,857 E335* probably null Het
Abcb1b A T 5: 8,812,671 T118S probably benign Het
Abcb1b T A 5: 8,861,602 I133N probably damaging Het
Acox3 A G 5: 35,589,736 N166D probably damaging Het
Adam5 T C 8: 24,786,232 Y473C probably damaging Het
Ankmy2 A G 12: 36,186,918 K242E possibly damaging Het
Apc2 A C 10: 80,314,007 I1603L probably benign Het
Arhgef25 T A 10: 127,185,603 I249F probably damaging Het
Birc3 T C 9: 7,860,552 H255R probably benign Het
Cables1 A T 18: 11,941,277 R486W possibly damaging Het
Caskin1 A T 17: 24,507,161 D1414V probably damaging Het
Ccdc175 A G 12: 72,180,845 S55P probably damaging Het
Ccdc57 A T 11: 120,861,152 S868T probably benign Het
Ccny A T 18: 9,449,516 probably null Het
Cdc34b A T 11: 94,742,261 I96F probably damaging Het
Ctnnd1 A G 2: 84,622,073 F69L possibly damaging Het
Cul9 C T 17: 46,538,525 D565N probably damaging Het
Cxcl16 A G 11: 70,455,693 V208A probably benign Het
Cyb5rl A G 4: 107,069,132 probably benign Het
Ddx18 T C 1: 121,566,094 K54E probably benign Het
Ddx60 G A 8: 61,979,338 V885I probably damaging Het
Dlg1 C T 16: 31,754,808 T9I probably benign Het
Dnase1 T C 16: 4,037,907 probably benign Het
Drd4 T C 7: 141,293,777 M114T probably damaging Het
Egfr A T 11: 16,908,949 D976V probably damaging Het
Eif2s1 T A 12: 78,880,011 N178K probably benign Het
Exoc3l4 A G 12: 111,428,721 H591R probably benign Het
Galntl6 T C 8: 58,699,911 probably benign Het
Glipr1l2 T A 10: 112,106,999 I253K possibly damaging Het
Gnat1 A T 9: 107,677,234 M115K probably benign Het
Gtsf2 T C 15: 103,444,328 E88G possibly damaging Het
Hormad1 T A 3: 95,585,220 probably null Het
Hydin A T 8: 110,490,673 I1398F possibly damaging Het
Ifnar1 T C 16: 91,505,086 V483A probably benign Het
Ints11 T C 4: 155,886,928 F278L probably damaging Het
Ints6 A G 14: 62,702,462 L593P probably damaging Het
Krt7 C T 15: 101,413,972 R104C probably damaging Het
Mef2d T A 3: 88,168,097 I422N probably damaging Het
Mipep G T 14: 60,784,782 R32L probably damaging Het
Mon1a A G 9: 107,902,651 E473G probably damaging Het
Mterf2 T A 10: 85,120,115 Q215L probably damaging Het
Mybpc1 T A 10: 88,555,663 Y324F probably benign Het
Myh11 T C 16: 14,205,954 E1512G probably damaging Het
Myo1g A T 11: 6,515,976 F370I probably damaging Het
Myo5c T A 9: 75,297,509 M1548K possibly damaging Het
Myof T A 19: 37,935,852 I1306F probably damaging Het
Nle1 A G 11: 82,908,192 F21S probably damaging Het
Noc2l C G 4: 156,245,911 D513E probably damaging Het
Olfr23 A T 11: 73,941,202 I319F probably benign Het
Olfr30 A G 11: 58,455,907 V14A probably benign Het
Orc1 T C 4: 108,614,473 *841R probably null Het
Patz1 A G 11: 3,307,720 D573G probably damaging Het
Pcdhga3 A G 18: 37,676,101 T536A probably benign Het
Pde6h C T 6: 136,961,203 T58I possibly damaging Het
Pip5k1a T C 3: 95,070,783 I275V probably benign Het
Pkd1 T C 17: 24,586,068 probably null Het
Polr1e G A 4: 45,029,429 A297T probably damaging Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Rbm34 T C 8: 126,951,337 D269G possibly damaging Het
Rnf122 T A 8: 31,112,149 M1K probably null Het
Rnf32 G A 5: 29,198,578 R7H probably benign Het
Ryr2 T C 13: 11,714,611 E2375G possibly damaging Het
Ryr2 T C 13: 11,833,992 T361A probably benign Het
Serpina3m T C 12: 104,389,101 I9T probably benign Het
Serpinb9 T A 13: 33,008,864 W135R probably damaging Het
Sf3b1 T C 1: 54,999,712 N804S probably benign Het
Shroom1 A G 11: 53,465,172 T350A probably benign Het
Slc24a5 G A 2: 125,068,268 V30I probably benign Het
Slc38a8 A T 8: 119,482,684 probably null Het
Smarcd1 A G 15: 99,707,981 S378G possibly damaging Het
Stx1b T C 7: 127,807,921 I55V probably damaging Het
Sult2a8 A G 7: 14,425,532 V54A probably damaging Het
Tacc2 T C 7: 130,728,777 S264P probably damaging Het
Tbc1d4 A T 14: 101,458,174 Y943N probably damaging Het
Tlr5 T C 1: 182,973,473 I114T probably benign Het
Tmco6 T C 18: 36,735,502 probably null Het
Treh T C 9: 44,682,648 L144P probably damaging Het
Trmt2a T A 16: 18,249,554 C30* probably null Het
Ttbk2 A T 2: 120,773,277 F258L possibly damaging Het
Ttn T C 2: 76,955,036 D665G probably damaging Het
Unc93b1 T C 19: 3,942,023 probably null Het
Uroc1 T C 6: 90,345,394 L300P probably damaging Het
Xbp1 A G 11: 5,521,125 E44G probably damaging Het
Zfp451 A T 1: 33,777,861 V119D probably damaging Het
Zfp457 T A 13: 67,293,278 H315L probably damaging Het
Zfp518a T A 19: 40,915,851 V1408D possibly damaging Het
Zfp52 T G 17: 21,560,403 L171R probably benign Het
Zfp712 C T 13: 67,040,612 C617Y probably damaging Het
Zfp770 T C 2: 114,197,387 N67S probably benign Het
Other mutations in Map4k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Map4k1 APN 7 29001619 missense probably damaging 0.98
IGL01936:Map4k1 APN 7 28988607 missense possibly damaging 0.90
IGL02473:Map4k1 APN 7 28999872 missense probably damaging 1.00
IGL02934:Map4k1 APN 7 28994106 missense probably benign 0.00
IGL03180:Map4k1 APN 7 28988085 missense probably damaging 1.00
IGL03199:Map4k1 APN 7 28983417 missense probably damaging 1.00
IGL03493:Map4k1 APN 7 28984151 unclassified probably benign
R0333:Map4k1 UTSW 7 28999761 unclassified probably benign
R1296:Map4k1 UTSW 7 28998452 missense possibly damaging 0.96
R1305:Map4k1 UTSW 7 28995465 missense probably benign
R1519:Map4k1 UTSW 7 28991036 missense probably benign 0.00
R1711:Map4k1 UTSW 7 28989352 missense possibly damaging 0.80
R1842:Map4k1 UTSW 7 28987163 missense probably damaging 1.00
R1851:Map4k1 UTSW 7 28999784 missense probably benign
R2042:Map4k1 UTSW 7 28984130 missense probably damaging 1.00
R2274:Map4k1 UTSW 7 29001957 missense probably damaging 1.00
R2275:Map4k1 UTSW 7 29001957 missense probably damaging 1.00
R4426:Map4k1 UTSW 7 28988595 missense probably damaging 1.00
R4568:Map4k1 UTSW 7 28986654 missense probably damaging 1.00
R4858:Map4k1 UTSW 7 28988770 missense probably damaging 1.00
R4903:Map4k1 UTSW 7 28983002 missense probably benign 0.01
R4966:Map4k1 UTSW 7 28983002 missense probably benign 0.01
R5124:Map4k1 UTSW 7 28988832 missense probably damaging 1.00
R5778:Map4k1 UTSW 7 28994221 missense probably benign 0.37
R5786:Map4k1 UTSW 7 29000020 missense probably damaging 1.00
R6343:Map4k1 UTSW 7 29000290 missense possibly damaging 0.76
R6475:Map4k1 UTSW 7 28987022 missense probably damaging 1.00
R6702:Map4k1 UTSW 7 29002396 missense possibly damaging 0.86
R6703:Map4k1 UTSW 7 29002396 missense possibly damaging 0.86
R6856:Map4k1 UTSW 7 28986834 missense probably damaging 1.00
R6870:Map4k1 UTSW 7 29001671 critical splice donor site probably null
R6904:Map4k1 UTSW 7 28986802 missense probably damaging 1.00
R7081:Map4k1 UTSW 7 28991149 missense probably benign
R7572:Map4k1 UTSW 7 28987138 missense probably benign 0.01
R7868:Map4k1 UTSW 7 28999962 critical splice acceptor site probably null
R8034:Map4k1 UTSW 7 28988148 missense probably damaging 1.00
R8054:Map4k1 UTSW 7 28989756 splice site probably benign
R8512:Map4k1 UTSW 7 28996158 missense possibly damaging 0.88
R8686:Map4k1 UTSW 7 28994073 missense probably benign 0.04
R8723:Map4k1 UTSW 7 28987117 missense probably damaging 0.99
R8743:Map4k1 UTSW 7 28987117 missense probably damaging 0.99
R8745:Map4k1 UTSW 7 28987117 missense probably damaging 0.99
R8885:Map4k1 UTSW 7 28989437 missense probably benign 0.00
R8921:Map4k1 UTSW 7 29001627 missense probably damaging 0.96
Z1177:Map4k1 UTSW 7 29000008 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCAAACTCTCAGAACCCAGGGG -3'
(R):5'- AGCTTGCCATCCTCAGCATC -3'

Sequencing Primer
(F):5'- TGGAGCCCTCTGTGCAG -3'
(R):5'- TCTCTGAACCAAGGCCAAGG -3'
Posted On2016-04-27