Incidental Mutation 'R5061:Ocln'
ID386641
Institutional Source Beutler Lab
Gene Symbol Ocln
Ensembl Gene ENSMUSG00000021638
Gene Nameoccludin
SynonymsOcl
MMRRC Submission 042651-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.739) question?
Stock #R5061 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location100496507-100552718 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100539598 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 129 (Y129C)
Ref Sequence ENSEMBL: ENSMUSP00000124849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022140] [ENSMUST00000069756] [ENSMUST00000159459] [ENSMUST00000159515] [ENSMUST00000160859]
Predicted Effect probably damaging
Transcript: ENSMUST00000022140
AA Change: Y129C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022140
Gene: ENSMUSG00000021638
AA Change: Y129C

DomainStartEndE-ValueType
Pfam:MARVEL 57 261 6.6e-29 PFAM
Pfam:Occludin_ELL 419 518 8.8e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000069756
AA Change: Y129C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065284
Gene: ENSMUSG00000021638
AA Change: Y129C

DomainStartEndE-ValueType
Pfam:MARVEL 57 261 3.3e-29 PFAM
Pfam:Occludin_ELL 419 518 3.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159459
SMART Domains Protein: ENSMUSP00000125642
Gene: ENSMUSG00000021638

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Occludin_ELL 170 269 6.1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159515
SMART Domains Protein: ENSMUSP00000125595
Gene: ENSMUSG00000021638

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160859
AA Change: Y129C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124849
Gene: ENSMUSG00000021638
AA Change: Y129C

DomainStartEndE-ValueType
Pfam:MARVEL 57 261 6.6e-29 PFAM
Pfam:Occludin_ELL 419 518 8.8e-35 PFAM
Meta Mutation Damage Score 0.7613 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that is required for cytokine-induced regulation of the tight junction paracellular permeability barrier. Mutations in this gene are thought to be a cause of band-like calcification with simplified gyration and polymicrogyria (BLC-PMG), an autosomal recessive neurologic disorder that is also known as pseudo-TORCH syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene is present 1.5 Mb downstream on the q arm of chromosome 5. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous null mice display gastritis, loss of gastric parietal and chief cells, gastric mucus cell hyperplasia, reduced gastric acid secretion, growth retardation, male infertility, seminiferous tubule atrophy, failure to nurse pups, mineral deposits in the brain, and thinning of the compact bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A G 4: 39,450,953 H53R probably benign Het
Abcg1 A G 17: 31,092,392 K124E probably damaging Het
Acot4 G T 12: 84,038,701 R64L probably benign Het
Adam22 G C 5: 8,180,238 probably benign Het
Add2 G A 6: 86,087,047 probably null Het
Adgrb3 G A 1: 25,068,128 probably benign Het
Akap8l T G 17: 32,332,894 K441T probably damaging Het
Aspn T A 13: 49,566,604 S365R probably damaging Het
Atxn1 T G 13: 45,557,093 K788Q probably damaging Het
Atxn2l G T 7: 126,500,203 H135N probably damaging Het
Borcs8 T G 8: 70,140,358 probably null Het
Col5a1 G A 2: 27,952,378 D422N unknown Het
Cstad A T 2: 30,608,263 T37S unknown Het
Dgkq A T 5: 108,654,123 D455E probably benign Het
Dopey1 T C 9: 86,503,108 probably benign Het
Ebf3 T C 7: 137,313,559 I84V possibly damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eif3e A T 15: 43,252,261 W370R probably damaging Het
Eya3 T A 4: 132,704,378 D323E probably damaging Het
F5 T C 1: 164,194,180 L1408P probably benign Het
Gfod1 C T 13: 43,200,516 G328S probably benign Het
Gja1 T A 10: 56,387,656 L37Q probably damaging Het
Gm10650 T A 3: 128,040,017 noncoding transcript Het
Gm14226 T A 2: 155,025,186 H354Q probably benign Het
Gm15056 T C 8: 20,900,742 T60A probably benign Het
Gm6614 T A 6: 142,008,688 M20L probably benign Het
Grrp1 T C 4: 134,251,730 T146A probably benign Het
Hsd11b1 A T 1: 193,242,245 N6K probably benign Het
Ighv1-36 T C 12: 114,880,122 I39M probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kdm7a G A 6: 39,151,452 P482S possibly damaging Het
Lama5 C A 2: 180,198,786 E607* probably null Het
Lao1 T A 4: 118,967,476 S252T probably benign Het
Lrp12 A G 15: 39,878,254 F355S probably damaging Het
Mlycd T C 8: 119,410,304 F421S probably damaging Het
Nectin3 T C 16: 46,448,449 E530G probably benign Het
Nifk T C 1: 118,332,939 *270R probably null Het
Olfr1130 C T 2: 87,607,832 T148I probably benign Het
Olfr1278 T A 2: 111,292,487 L73H probably damaging Het
Olfr1472 A T 19: 13,453,985 C177* probably null Het
Olfr685 T A 7: 105,180,657 I219F possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Ppcs T C 4: 119,419,215 K58E probably damaging Het
Prss38 T C 11: 59,374,370 T123A probably damaging Het
Rap1gap T A 4: 137,720,433 probably null Het
Rbm18 A G 2: 36,127,205 F54L possibly damaging Het
Rwdd3 G A 3: 121,159,783 probably benign Het
Ryr2 T C 13: 11,635,536 K138E possibly damaging Het
Sec24a T C 11: 51,713,532 probably null Het
Serpinb10 A G 1: 107,540,971 T115A probably benign Het
Slx4ip T G 2: 137,044,010 F83L probably damaging Het
St3gal1 A T 15: 67,108,229 S274T probably benign Het
Stab1 A C 14: 31,163,099 C121W probably damaging Het
Stab2 A G 10: 86,907,385 L1149P probably damaging Het
Svil T G 18: 5,048,954 I77R probably benign Het
Tbk1 T G 10: 121,576,336 E47A possibly damaging Het
Tert C T 13: 73,634,278 T557I probably damaging Het
Tfap2c A G 2: 172,552,027 D252G probably damaging Het
Tll1 C A 8: 64,053,949 C586F probably damaging Het
Tln2 T G 9: 67,354,468 N663T probably benign Het
Tmem245 T A 4: 56,946,945 Y156F possibly damaging Het
Uhrf1 G T 17: 56,320,542 probably null Het
Unc79 T A 12: 103,168,441 M2417K possibly damaging Het
Ush2a T C 1: 188,957,274 V5011A probably benign Het
Virma T C 4: 11,494,840 V47A possibly damaging Het
Vmn2r53 A C 7: 12,581,814 S693A probably benign Het
Vps54 G A 11: 21,319,881 probably benign Het
Znfx1 T C 2: 167,065,398 probably benign Het
Other mutations in Ocln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Ocln APN 13 100535013 missense probably damaging 1.00
IGL02231:Ocln APN 13 100541114 missense probably damaging 1.00
LCD18:Ocln UTSW 13 100520567 intron probably benign
R0635:Ocln UTSW 13 100506236 missense probably damaging 1.00
R1809:Ocln UTSW 13 100511459 nonsense probably null
R2047:Ocln UTSW 13 100535124 missense probably damaging 1.00
R2193:Ocln UTSW 13 100539904 missense probably damaging 0.99
R2259:Ocln UTSW 13 100535029 missense probably damaging 1.00
R3793:Ocln UTSW 13 100498894 missense possibly damaging 0.50
R4534:Ocln UTSW 13 100511604 missense possibly damaging 0.63
R4947:Ocln UTSW 13 100539715 missense probably damaging 1.00
R5055:Ocln UTSW 13 100539422 missense probably benign 0.11
R5218:Ocln UTSW 13 100506314 missense probably damaging 1.00
R5302:Ocln UTSW 13 100506299 missense probably damaging 0.99
R5916:Ocln UTSW 13 100506179 missense possibly damaging 0.64
R6257:Ocln UTSW 13 100539509 missense probably benign 0.00
R6797:Ocln UTSW 13 100539715 missense probably damaging 1.00
R6960:Ocln UTSW 13 100498872 missense possibly damaging 0.89
R6967:Ocln UTSW 13 100539288 nonsense probably null
R7000:Ocln UTSW 13 100534962 critical splice donor site probably null
R7176:Ocln UTSW 13 100515082 missense probably damaging 0.97
R7176:Ocln UTSW 13 100515083 missense probably benign 0.16
R7709:Ocln UTSW 13 100539598 missense probably damaging 1.00
X0023:Ocln UTSW 13 100511582 missense probably benign 0.00
Z1088:Ocln UTSW 13 100535052 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCAATAAACACCATGATGCC -3'
(R):5'- TTCTACAAATGGACGTCGCC -3'

Sequencing Primer
(F):5'- CCAGGATAGCGCTGACTATGATC -3'
(R):5'- GTGATCCGGATCCTGTCTATGC -3'
Posted On2016-06-06