Incidental Mutation 'R5302:Ocln'
ID404315
Institutional Source Beutler Lab
Gene Symbol Ocln
Ensembl Gene ENSMUSG00000021638
Gene Nameoccludin
SynonymsOcl
MMRRC Submission 042885-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.750) question?
Stock #R5302 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location100496507-100552718 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100506299 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 176 (D176G)
Ref Sequence ENSEMBL: ENSMUSP00000125642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022140] [ENSMUST00000069756] [ENSMUST00000159459] [ENSMUST00000160859]
Predicted Effect probably damaging
Transcript: ENSMUST00000022140
AA Change: D425G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022140
Gene: ENSMUSG00000021638
AA Change: D425G

DomainStartEndE-ValueType
Pfam:MARVEL 57 261 6.6e-29 PFAM
Pfam:Occludin_ELL 419 518 8.8e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000069756
AA Change: D425G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065284
Gene: ENSMUSG00000021638
AA Change: D425G

DomainStartEndE-ValueType
Pfam:MARVEL 57 261 3.3e-29 PFAM
Pfam:Occludin_ELL 419 518 3.8e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159459
AA Change: D176G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125642
Gene: ENSMUSG00000021638
AA Change: D176G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Occludin_ELL 170 269 6.1e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160859
AA Change: D425G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124849
Gene: ENSMUSG00000021638
AA Change: D425G

DomainStartEndE-ValueType
Pfam:MARVEL 57 261 6.6e-29 PFAM
Pfam:Occludin_ELL 419 518 8.8e-35 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that is required for cytokine-induced regulation of the tight junction paracellular permeability barrier. Mutations in this gene are thought to be a cause of band-like calcification with simplified gyration and polymicrogyria (BLC-PMG), an autosomal recessive neurologic disorder that is also known as pseudo-TORCH syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene is present 1.5 Mb downstream on the q arm of chromosome 5. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous null mice display gastritis, loss of gastric parietal and chief cells, gastric mucus cell hyperplasia, reduced gastric acid secretion, growth retardation, male infertility, seminiferous tubule atrophy, failure to nurse pups, mineral deposits in the brain, and thinning of the compact bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,283,952 V1657A possibly damaging Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Acot5 A G 12: 84,073,441 Y190C probably damaging Het
Ascc3 T A 10: 50,707,777 Y941N probably benign Het
BC035947 A T 1: 78,511,962 M1K probably null Het
C2cd5 A G 6: 143,073,756 C278R probably benign Het
Cd200r1 G T 16: 44,792,809 L259F possibly damaging Het
Clcn4 A G 7: 7,294,051 V136A possibly damaging Het
Cntnap5a T C 1: 116,157,570 S413P probably benign Het
Corin T A 5: 72,316,098 E748D probably benign Het
Crtc2 G T 3: 90,261,018 G356V probably damaging Het
D1Pas1 T A 1: 186,969,445 Y524N probably damaging Het
Dlgap4 T C 2: 156,760,898 S147P probably damaging Het
Enpp1 A T 10: 24,651,390 I633N probably benign Het
Gm3095 A G 14: 3,964,498 D72G probably null Het
Gm5449 C T 13: 53,525,751 noncoding transcript Het
Gm6803 T A 12: 88,018,546 I76F probably damaging Het
Gpx7 T C 4: 108,400,914 T161A probably benign Het
Grip1 T C 10: 120,020,077 L236P probably damaging Het
H2-Q2 G T 17: 35,344,909 R255S probably damaging Het
Il17rc G T 6: 113,483,036 A648S possibly damaging Het
Klhl12 A G 1: 134,489,451 E540G possibly damaging Het
Mcm10 T C 2: 5,007,370 I135V probably benign Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Nid2 A G 14: 19,779,701 T687A probably benign Het
Npas3 A T 12: 54,068,836 D829V probably damaging Het
Olfr745 A G 14: 50,642,319 probably null Het
Pax3 A C 1: 78,121,612 M380R possibly damaging Het
Pcdha3 A G 18: 36,948,155 E650G probably damaging Het
Pdcd11 C A 19: 47,107,644 H668N probably damaging Het
Polr3b T C 10: 84,699,400 Y858H possibly damaging Het
Pus10 T C 11: 23,667,416 probably null Het
Raver1 T C 9: 21,075,381 D739G probably damaging Het
Slc26a11 T C 11: 119,363,450 L198P probably damaging Het
Slc44a3 A G 3: 121,510,313 V258A probably damaging Het
Socs7 T A 11: 97,389,199 I524N probably damaging Het
Steap4 T A 5: 7,975,547 L36* probably null Het
Svep1 G C 4: 58,096,183 T1479S possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Ttn C A 2: 76,717,275 V32184F probably damaging Het
Vmn1r22 T C 6: 57,900,975 N6D possibly damaging Het
Other mutations in Ocln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Ocln APN 13 100535013 missense probably damaging 1.00
IGL02231:Ocln APN 13 100541114 missense probably damaging 1.00
LCD18:Ocln UTSW 13 100520567 intron probably benign
R0635:Ocln UTSW 13 100506236 missense probably damaging 1.00
R1809:Ocln UTSW 13 100511459 nonsense probably null
R2047:Ocln UTSW 13 100535124 missense probably damaging 1.00
R2193:Ocln UTSW 13 100539904 missense probably damaging 0.99
R2259:Ocln UTSW 13 100535029 missense probably damaging 1.00
R3793:Ocln UTSW 13 100498894 missense possibly damaging 0.50
R4534:Ocln UTSW 13 100511604 missense possibly damaging 0.63
R4947:Ocln UTSW 13 100539715 missense probably damaging 1.00
R5055:Ocln UTSW 13 100539422 missense probably benign 0.11
R5061:Ocln UTSW 13 100539598 missense probably damaging 1.00
R5218:Ocln UTSW 13 100506314 missense probably damaging 1.00
R5916:Ocln UTSW 13 100506179 missense possibly damaging 0.64
R6257:Ocln UTSW 13 100539509 missense probably benign 0.00
R6797:Ocln UTSW 13 100539715 missense probably damaging 1.00
R6960:Ocln UTSW 13 100498872 missense possibly damaging 0.89
R6967:Ocln UTSW 13 100539288 nonsense probably null
R7000:Ocln UTSW 13 100534962 critical splice donor site probably null
R7176:Ocln UTSW 13 100515082 missense probably damaging 0.97
R7176:Ocln UTSW 13 100515083 missense probably benign 0.16
R7709:Ocln UTSW 13 100539598 missense probably damaging 1.00
X0023:Ocln UTSW 13 100511582 missense probably benign 0.00
Z1088:Ocln UTSW 13 100535052 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCATATCTACAGTTCTGAGTTGAG -3'
(R):5'- GGGCAGCGTACCCTTACTTTTC -3'

Sequencing Primer
(F):5'- GAATTCAGTGCCATCCTCAGG -3'
(R):5'- GAAATTAATGGCACCTTACCTTTCTC -3'
Posted On2016-07-22