Incidental Mutation 'R5063:Slc25a45'
ID386778
Institutional Source Beutler Lab
Gene Symbol Slc25a45
Ensembl Gene ENSMUSG00000024818
Gene Namesolute carrier family 25, member 45
Synonyms
MMRRC Submission 042653-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5063 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location5877808-5885766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5884462 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 153 (S153P)
Ref Sequence ENSEMBL: ENSMUSP00000121596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025732] [ENSMUST00000125114] [ENSMUST00000136833] [ENSMUST00000145200] [ENSMUST00000155697]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025732
AA Change: S153P

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025732
Gene: ENSMUSG00000024818
AA Change: S153P

DomainStartEndE-ValueType
Pfam:Mito_carr 1 87 1.2e-20 PFAM
Pfam:Mito_carr 95 195 6.9e-22 PFAM
Pfam:Mito_carr 197 288 7e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125114
AA Change: S153P

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122076
Gene: ENSMUSG00000024818
AA Change: S153P

DomainStartEndE-ValueType
Pfam:Mito_carr 1 87 4.7e-22 PFAM
Pfam:Mito_carr 95 195 3.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136833
SMART Domains Protein: ENSMUSP00000121602
Gene: ENSMUSG00000024818

DomainStartEndE-ValueType
Pfam:Mito_carr 1 102 2.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141362
SMART Domains Protein: ENSMUSP00000114648
Gene: ENSMUSG00000024818

DomainStartEndE-ValueType
Pfam:Mito_carr 1 70 3.1e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000145200
AA Change: S95P

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117220
Gene: ENSMUSG00000024818
AA Change: S95P

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Mito_carr 37 137 5.1e-23 PFAM
Pfam:Mito_carr 139 195 4.1e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000155697
AA Change: S153P

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121596
Gene: ENSMUSG00000024818
AA Change: S153P

DomainStartEndE-ValueType
Pfam:Mito_carr 1 87 8.9e-22 PFAM
Pfam:Mito_carr 95 195 6.8e-23 PFAM
Pfam:Mito_carr 197 288 2.4e-23 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC25A45 belongs to the SLC25 family of mitochondrial carrier proteins (Haitina et al., 2006 [PubMed 16949250]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,885,955 I593T possibly damaging Het
Aatk T C 11: 120,010,489 H970R probably benign Het
Anapc1 T C 2: 128,629,549 M1496V possibly damaging Het
Arhgef4 A T 1: 34,724,215 T851S probably benign Het
Cacna1d A G 14: 30,051,383 S1782P probably benign Het
Capn13 T A 17: 73,322,079 R578* probably null Het
Casp8 A T 1: 58,844,374 H280L probably damaging Het
Cd274 G T 19: 29,384,143 D284Y probably damaging Het
Cenpe T A 3: 135,270,954 C2441S probably damaging Het
Chn2 A T 6: 54,290,287 K118* probably null Het
Chst12 G T 5: 140,524,412 E265* probably null Het
Cp C A 3: 19,989,215 Q22K probably benign Het
Diaph3 A T 14: 86,984,870 W404R probably damaging Het
Dnajb13 T G 7: 100,510,823 E69A probably damaging Het
Dzip1l A G 9: 99,667,652 E725G probably damaging Het
Dzip3 T A 16: 48,953,754 K373* probably null Het
Fmn1 C T 2: 113,364,921 T322I unknown Het
Gbp9 T C 5: 105,085,162 Y208C probably benign Het
Gtf2i T A 5: 134,260,571 K418N probably damaging Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Iqcm A T 8: 75,746,286 D251V probably damaging Het
Itpr3 A T 17: 27,089,911 I363F possibly damaging Het
Khnyn A T 14: 55,887,203 K305* probably null Het
Klf17 A G 4: 117,760,659 V167A possibly damaging Het
Letm2 T C 8: 25,581,779 D369G probably benign Het
Lrrc31 A G 3: 30,689,936 V141A possibly damaging Het
Msh5 A T 17: 35,042,188 probably null Het
Neb G A 2: 52,223,212 probably benign Het
Olfr16 T A 1: 172,957,442 S216T possibly damaging Het
Olfr720 A T 14: 14,175,593 M163K probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Padi6 T C 4: 140,741,880 I50V probably benign Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Ppy A G 11: 102,100,699 Y5H probably benign Het
Psmc1 T C 12: 100,115,475 L112S probably damaging Het
Ptov1 A G 7: 44,865,602 I195T possibly damaging Het
Rassf10 C A 7: 112,954,424 D77E probably benign Het
Slco1a5 G A 6: 142,259,065 R126C probably damaging Het
Srebf2 T C 15: 82,177,451 V366A probably benign Het
St6galnac5 T C 3: 152,981,135 S61G probably benign Het
Sult6b1 A T 17: 78,905,576 V82D probably benign Het
Tep1 A T 14: 50,850,627 C818S possibly damaging Het
Tex15 T G 8: 33,582,610 F2728L possibly damaging Het
Tm9sf2 T A 14: 122,145,146 F190Y probably damaging Het
Tmem175 T C 5: 108,646,432 L476P probably damaging Het
Tmprss11c T C 5: 86,237,830 K248R probably benign Het
Tnk2 T A 16: 32,670,850 F316I probably damaging Het
Vmn2r75 T A 7: 86,164,164 M477L probably benign Het
Vmn2r83 A C 10: 79,479,087 I390L probably benign Het
Vmn2r88 A G 14: 51,411,146 Y49C probably damaging Het
Zdhhc4 T A 5: 143,316,622 I318F probably damaging Het
Zmat4 A T 8: 23,748,441 D27V probably damaging Het
Other mutations in Slc25a45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02523:Slc25a45 APN 19 5884609 splice site probably null
IGL02620:Slc25a45 APN 19 5884526 missense probably damaging 1.00
IGL02622:Slc25a45 APN 19 5878697 splice site probably benign
R0055:Slc25a45 UTSW 19 5880467 missense probably damaging 1.00
R0055:Slc25a45 UTSW 19 5880467 missense probably damaging 1.00
R0630:Slc25a45 UTSW 19 5880528 missense probably damaging 1.00
R1464:Slc25a45 UTSW 19 5879900 splice site probably benign
R1764:Slc25a45 UTSW 19 5884930 missense probably damaging 1.00
R1902:Slc25a45 UTSW 19 5884522 missense probably damaging 1.00
R2372:Slc25a45 UTSW 19 5884552 missense probably benign 0.00
R3547:Slc25a45 UTSW 19 5884546 missense probably damaging 1.00
R3889:Slc25a45 UTSW 19 5880633 splice site probably benign
R4173:Slc25a45 UTSW 19 5880583 nonsense probably null
R4222:Slc25a45 UTSW 19 5880118 missense probably damaging 1.00
R4223:Slc25a45 UTSW 19 5880118 missense probably damaging 1.00
R4225:Slc25a45 UTSW 19 5880118 missense probably damaging 1.00
R4598:Slc25a45 UTSW 19 5884436 missense probably damaging 1.00
R4998:Slc25a45 UTSW 19 5884917 missense probably damaging 1.00
R5711:Slc25a45 UTSW 19 5884423 missense probably benign
R6693:Slc25a45 UTSW 19 5880134 missense possibly damaging 0.63
R7486:Slc25a45 UTSW 19 5884969 missense probably damaging 0.96
R8437:Slc25a45 UTSW 19 5880107 missense probably benign 0.06
Z1177:Slc25a45 UTSW 19 5880179 missense unknown
Z1177:Slc25a45 UTSW 19 5884432 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTGTTGTGATGAAAAGCTGAC -3'
(R):5'- AGAACAGAGCATCTTCCAGTCC -3'

Sequencing Primer
(F):5'- AGCTGACATTTTTCAAGCCTAAGCC -3'
(R):5'- AGTTCCCTCCGTCGCCTATG -3'
Posted On2016-06-06