Incidental Mutation 'R2372:Slc25a45'
ID248185
Institutional Source Beutler Lab
Gene Symbol Slc25a45
Ensembl Gene ENSMUSG00000024818
Gene Namesolute carrier family 25, member 45
Synonyms
MMRRC Submission 040352-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R2372 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5877808-5885766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 5884552 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 183 (V183I)
Ref Sequence ENSEMBL: ENSMUSP00000121596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025732] [ENSMUST00000125114] [ENSMUST00000136833] [ENSMUST00000145200] [ENSMUST00000155697]
Predicted Effect probably benign
Transcript: ENSMUST00000025732
AA Change: V183I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000025732
Gene: ENSMUSG00000024818
AA Change: V183I

DomainStartEndE-ValueType
Pfam:Mito_carr 1 87 1.2e-20 PFAM
Pfam:Mito_carr 95 195 6.9e-22 PFAM
Pfam:Mito_carr 197 288 7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125114
AA Change: V183I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000122076
Gene: ENSMUSG00000024818
AA Change: V183I

DomainStartEndE-ValueType
Pfam:Mito_carr 1 87 4.7e-22 PFAM
Pfam:Mito_carr 95 195 3.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136833
SMART Domains Protein: ENSMUSP00000121602
Gene: ENSMUSG00000024818

DomainStartEndE-ValueType
Pfam:Mito_carr 1 102 2.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141362
SMART Domains Protein: ENSMUSP00000114648
Gene: ENSMUSG00000024818

DomainStartEndE-ValueType
Pfam:Mito_carr 1 70 3.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145200
AA Change: V125I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117220
Gene: ENSMUSG00000024818
AA Change: V125I

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Mito_carr 37 137 5.1e-23 PFAM
Pfam:Mito_carr 139 195 4.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155697
AA Change: V183I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000121596
Gene: ENSMUSG00000024818
AA Change: V183I

DomainStartEndE-ValueType
Pfam:Mito_carr 1 87 8.9e-22 PFAM
Pfam:Mito_carr 95 195 6.8e-23 PFAM
Pfam:Mito_carr 197 288 2.4e-23 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC25A45 belongs to the SLC25 family of mitochondrial carrier proteins (Haitina et al., 2006 [PubMed 16949250]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,360,280 L135S probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpi G T 1: 87,100,594 T169N probably damaging Het
Ccdc15 T C 9: 37,315,505 D378G possibly damaging Het
Cpb2 T G 14: 75,268,050 V162G probably damaging Het
Dnmbp T C 19: 43,902,320 E336G probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Eef1d G A 15: 75,896,317 R199C probably damaging Het
Epha8 T C 4: 136,933,010 Y714C probably damaging Het
Fyb T C 15: 6,651,907 probably benign Het
Gfpt2 A G 11: 49,807,715 N46D probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11596 C A 11: 99,793,256 E13* probably null Het
Gsx2 T C 5: 75,077,052 F222L probably damaging Het
Hpca T A 4: 129,118,444 K100* probably null Het
Iqsec1 A G 6: 90,694,654 S89P probably damaging Het
Kif12 T A 4: 63,168,559 T347S possibly damaging Het
Knop1 A G 7: 118,853,217 L93S probably damaging Het
Mib1 A G 18: 10,812,045 T981A probably damaging Het
N4bp2l1 C T 5: 150,572,781 E123K probably damaging Het
Npr2 C T 4: 43,650,432 R976W probably damaging Het
Rbpj T C 5: 53,642,195 probably benign Het
Ruvbl1 T C 6: 88,485,797 V301A possibly damaging Het
Sgip1 T C 4: 102,909,791 probably null Het
Sh3bp2 T C 5: 34,559,496 I361T probably benign Het
Skint1 T A 4: 112,019,151 Y90N probably damaging Het
Slco4c1 T A 1: 96,821,200 H664L probably benign Het
Sult2a4 T A 7: 13,915,300 I194L probably benign Het
Tecta C A 9: 42,388,274 D173Y probably damaging Het
Tnrc18 T A 5: 142,759,704 probably benign Het
Trove2 C A 1: 143,770,882 E42* probably null Het
Use1 T C 8: 71,369,179 L169P possibly damaging Het
Zfp335 A G 2: 164,895,039 L918P probably damaging Het
Zfp451 A T 1: 33,780,052 probably null Het
Other mutations in Slc25a45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02523:Slc25a45 APN 19 5884609 splice site probably null
IGL02620:Slc25a45 APN 19 5884526 missense probably damaging 1.00
IGL02622:Slc25a45 APN 19 5878697 splice site probably benign
R0055:Slc25a45 UTSW 19 5880467 missense probably damaging 1.00
R0055:Slc25a45 UTSW 19 5880467 missense probably damaging 1.00
R0630:Slc25a45 UTSW 19 5880528 missense probably damaging 1.00
R1464:Slc25a45 UTSW 19 5879900 splice site probably benign
R1764:Slc25a45 UTSW 19 5884930 missense probably damaging 1.00
R1902:Slc25a45 UTSW 19 5884522 missense probably damaging 1.00
R3547:Slc25a45 UTSW 19 5884546 missense probably damaging 1.00
R3889:Slc25a45 UTSW 19 5880633 splice site probably benign
R4173:Slc25a45 UTSW 19 5880583 nonsense probably null
R4222:Slc25a45 UTSW 19 5880118 missense probably damaging 1.00
R4223:Slc25a45 UTSW 19 5880118 missense probably damaging 1.00
R4225:Slc25a45 UTSW 19 5880118 missense probably damaging 1.00
R4598:Slc25a45 UTSW 19 5884436 missense probably damaging 1.00
R4998:Slc25a45 UTSW 19 5884917 missense probably damaging 1.00
R5063:Slc25a45 UTSW 19 5884462 missense possibly damaging 0.89
R5711:Slc25a45 UTSW 19 5884423 missense probably benign
R6693:Slc25a45 UTSW 19 5880134 missense possibly damaging 0.63
R7486:Slc25a45 UTSW 19 5884969 missense probably damaging 0.96
Z1177:Slc25a45 UTSW 19 5880179 missense unknown
Z1177:Slc25a45 UTSW 19 5884432 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACCTCATCAAAGTCCGTC -3'
(R):5'- TGTGATCCAGGAGGCTATGC -3'

Sequencing Primer
(F):5'- GTCCGTCTACAAAACCAGACAGAG -3'
(R):5'- ACCAGAACTGTGGCTGAACCTG -3'
Posted On2014-11-11