Incidental Mutation 'R5065:Bcl2l10'
ID388296
Institutional Source Beutler Lab
Gene Symbol Bcl2l10
Ensembl Gene ENSMUSG00000032191
Gene NameBcl2-like 10
SynonymsDiva, Boo
MMRRC Submission 042655-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5065 (G1)
Quality Score214
Status Validated
Chromosome9
Chromosomal Location75347758-75351632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75347979 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 26 (E26V)
Ref Sequence ENSEMBL: ENSMUSP00000034709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034709] [ENSMUST00000076889] [ENSMUST00000213990] [ENSMUST00000215875]
PDB Structure
Solution structure of a divergent Bcl-2 protein [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034709
AA Change: E26V

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034709
Gene: ENSMUSG00000032191
AA Change: E26V

DomainStartEndE-ValueType
BCL 42 151 1.35e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076889
SMART Domains Protein: ENSMUSP00000076155
Gene: ENSMUSG00000032192

DomainStartEndE-ValueType
WD40 94 133 3.52e-9 SMART
WD40 136 175 9.94e-1 SMART
WD40 184 223 9.9e-4 SMART
WD40 226 267 2.42e-7 SMART
WD40 270 309 1.99e-8 SMART
WD40 312 353 5.97e-1 SMART
WD40 356 395 6.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215346
Predicted Effect probably benign
Transcript: ENSMUST00000215875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216290
Meta Mutation Damage Score 0.1509 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the BCL-2 protein family. BCL-2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. The protein encoded by this gene contains conserved BH4, BH1 and BH2 domains. This protein can interact with other members of BCL-2 protein family including BCL2, BCL2L1/BCL-X(L), and BAX. Overexpression of this gene has been shown to suppress cell apoptosis possibly through the prevention of cytochrome C release from the mitochondria, and thus activating caspase-3 activation. The mouse counterpart of this protein is found to interact with Apaf1 and forms a protein complex with Caspase 9, which suggests the involvement of this protein in APAF1 and CASPASE 9 related apoptotic pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit no obvious abnormalities. They are viable and fertile with normal reproductive capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik T A 1: 138,852,155 N120Y probably damaging Het
A930011G23Rik G A 5: 99,234,573 T272M probably benign Het
Aldh9a1 A G 1: 167,352,559 E74G probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
BC067074 T A 13: 113,320,919 H1166Q probably benign Het
Dennd2a C A 6: 39,495,176 probably null Het
Dock3 A G 9: 106,955,684 F129L probably damaging Het
Gm4847 A T 1: 166,634,790 I377N probably damaging Het
Gm8674 T C 13: 49,902,577 noncoding transcript Het
Hhipl2 A T 1: 183,426,672 H433L probably benign Het
Hsfy2 G A 1: 56,636,467 Q304* probably null Het
Ighg2c T C 12: 113,288,088 I140V unknown Het
Kmt2a T C 9: 44,842,700 probably benign Het
Map3k5 A G 10: 20,082,467 E671G probably damaging Het
Map6 A G 7: 99,336,710 D607G probably benign Het
Mroh4 C T 15: 74,628,270 probably null Het
Olfr981 A G 9: 40,023,250 I286V probably benign Het
Pcsk6 A G 7: 65,910,299 D124G possibly damaging Het
Pkhd1l1 T A 15: 44,582,293 N3790K possibly damaging Het
Polr3b C A 10: 84,632,538 N129K probably benign Het
Ptpn23 A T 9: 110,398,188 L31Q possibly damaging Het
Sema3c A G 5: 17,727,617 N706S possibly damaging Het
Sipa1l2 T C 8: 125,491,585 I338V probably benign Het
Slc39a7 A G 17: 34,031,059 probably benign Het
Snd1 C A 6: 28,888,240 N891K probably damaging Het
Sntg1 A G 1: 8,363,439 probably benign Het
Stxbp5 A T 10: 9,770,551 L780Q probably damaging Het
Tacr1 G A 6: 82,554,878 V252M possibly damaging Het
Tdrp T C 8: 13,953,791 E182G probably damaging Het
Vmn1r58 A G 7: 5,410,835 I132T probably benign Het
Wap A T 11: 6,636,840 N86K probably damaging Het
Other mutations in Bcl2l10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03372:Bcl2l10 APN 9 75348047 missense probably benign 0.04
IGL03134:Bcl2l10 UTSW 9 75348198 missense probably damaging 1.00
R6274:Bcl2l10 UTSW 9 75351072 missense possibly damaging 0.84
R7026:Bcl2l10 UTSW 9 75351082 missense probably benign 0.03
R8292:Bcl2l10 UTSW 9 75347878 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCAAGTGATATTCCCAAATGTCC -3'
(R):5'- CTTGATTCATAAGCGTCCCCG -3'

Sequencing Primer
(F):5'- ATTCCCAAATGTCCAGGTGG -3'
(R):5'- AGTTGGCTCCAGCTGAAGTC -3'
Posted On2016-06-06