Incidental Mutation 'R5065:Bcl2l10'
ID 388296
Institutional Source Beutler Lab
Gene Symbol Bcl2l10
Ensembl Gene ENSMUSG00000032191
Gene Name Bcl2-like 10
Synonyms Diva, Boo
MMRRC Submission 042655-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5065 (G1)
Quality Score 214
Status Validated
Chromosome 9
Chromosomal Location 75255040-75258922 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 75255261 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 26 (E26V)
Ref Sequence ENSEMBL: ENSMUSP00000034709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034709] [ENSMUST00000076889] [ENSMUST00000213990] [ENSMUST00000215875]
AlphaFold Q9Z0F3
PDB Structure Solution structure of a divergent Bcl-2 protein [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034709
AA Change: E26V

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034709
Gene: ENSMUSG00000032191
AA Change: E26V

DomainStartEndE-ValueType
BCL 42 151 1.35e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076889
SMART Domains Protein: ENSMUSP00000076155
Gene: ENSMUSG00000032192

DomainStartEndE-ValueType
WD40 94 133 3.52e-9 SMART
WD40 136 175 9.94e-1 SMART
WD40 184 223 9.9e-4 SMART
WD40 226 267 2.42e-7 SMART
WD40 270 309 1.99e-8 SMART
WD40 312 353 5.97e-1 SMART
WD40 356 395 6.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215346
Predicted Effect probably benign
Transcript: ENSMUST00000215875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216290
Meta Mutation Damage Score 0.1509 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the BCL-2 protein family. BCL-2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. The protein encoded by this gene contains conserved BH4, BH1 and BH2 domains. This protein can interact with other members of BCL-2 protein family including BCL2, BCL2L1/BCL-X(L), and BAX. Overexpression of this gene has been shown to suppress cell apoptosis possibly through the prevention of cytochrome C release from the mitochondria, and thus activating caspase-3 activation. The mouse counterpart of this protein is found to interact with Apaf1 and forms a protein complex with Caspase 9, which suggests the involvement of this protein in APAF1 and CASPASE 9 related apoptotic pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit no obvious abnormalities. They are viable and fertile with normal reproductive capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik T A 1: 138,779,893 (GRCm39) N120Y probably damaging Het
A930011G23Rik G A 5: 99,382,432 (GRCm39) T272M probably benign Het
Aldh9a1 A G 1: 167,180,128 (GRCm39) E74G probably damaging Het
Asxl3 C G 18: 22,658,356 (GRCm39) A2122G possibly damaging Het
Cspg4b T A 13: 113,457,453 (GRCm39) H1166Q probably benign Het
Dennd2a C A 6: 39,472,110 (GRCm39) probably null Het
Dock3 A G 9: 106,832,883 (GRCm39) F129L probably damaging Het
Gm4847 A T 1: 166,462,359 (GRCm39) I377N probably damaging Het
Gm8674 T C 13: 50,056,613 (GRCm39) noncoding transcript Het
Hhipl2 A T 1: 183,207,580 (GRCm39) H433L probably benign Het
Hsfy2 G A 1: 56,675,626 (GRCm39) Q304* probably null Het
Ighg2c T C 12: 113,251,708 (GRCm39) I140V unknown Het
Kmt2a T C 9: 44,753,997 (GRCm39) probably benign Het
Map3k5 A G 10: 19,958,213 (GRCm39) E671G probably damaging Het
Map6 A G 7: 98,985,917 (GRCm39) D607G probably benign Het
Mroh4 C T 15: 74,500,119 (GRCm39) probably null Het
Or10g6 A G 9: 39,934,546 (GRCm39) I286V probably benign Het
Pcsk6 A G 7: 65,560,047 (GRCm39) D124G possibly damaging Het
Pkhd1l1 T A 15: 44,445,689 (GRCm39) N3790K possibly damaging Het
Polr3b C A 10: 84,468,402 (GRCm39) N129K probably benign Het
Ptpn23 A T 9: 110,227,256 (GRCm39) L31Q possibly damaging Het
Sema3c A G 5: 17,932,615 (GRCm39) N706S possibly damaging Het
Sipa1l2 T C 8: 126,218,324 (GRCm39) I338V probably benign Het
Slc39a7 A G 17: 34,250,033 (GRCm39) probably benign Het
Snd1 C A 6: 28,888,239 (GRCm39) N891K probably damaging Het
Sntg1 A G 1: 8,433,663 (GRCm39) probably benign Het
Stxbp5 A T 10: 9,646,295 (GRCm39) L780Q probably damaging Het
Tacr1 G A 6: 82,531,859 (GRCm39) V252M possibly damaging Het
Tdrp T C 8: 14,003,791 (GRCm39) E182G probably damaging Het
Vmn1r58 A G 7: 5,413,834 (GRCm39) I132T probably benign Het
Wap A T 11: 6,586,840 (GRCm39) N86K probably damaging Het
Other mutations in Bcl2l10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03372:Bcl2l10 APN 9 75,255,329 (GRCm39) missense probably benign 0.04
IGL03134:Bcl2l10 UTSW 9 75,255,480 (GRCm39) missense probably damaging 1.00
R6274:Bcl2l10 UTSW 9 75,258,354 (GRCm39) missense possibly damaging 0.84
R7026:Bcl2l10 UTSW 9 75,258,364 (GRCm39) missense probably benign 0.03
R8292:Bcl2l10 UTSW 9 75,255,160 (GRCm39) unclassified probably benign
R9193:Bcl2l10 UTSW 9 75,255,333 (GRCm39) missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GCAAGTGATATTCCCAAATGTCC -3'
(R):5'- CTTGATTCATAAGCGTCCCCG -3'

Sequencing Primer
(F):5'- ATTCCCAAATGTCCAGGTGG -3'
(R):5'- AGTTGGCTCCAGCTGAAGTC -3'
Posted On 2016-06-06