Incidental Mutation 'R5166:Gk5'
ID397310
Institutional Source Beutler Lab
Gene Symbol Gk5
Ensembl Gene ENSMUSG00000041440
Gene Nameglycerol kinase 5 (putative)
SynonymsC330018K18Rik, G630067D24Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5166 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location96119362-96184608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 96174768 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 413 (A413S)
Ref Sequence ENSEMBL: ENSMUSP00000112717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085217] [ENSMUST00000122383] [ENSMUST00000129774]
Predicted Effect probably damaging
Transcript: ENSMUST00000085217
AA Change: A413S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082313
Gene: ENSMUSG00000041440
AA Change: A413S

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:FGGY_N 25 287 9e-50 PFAM
Pfam:FGGY_C 296 485 7.7e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122383
AA Change: A413S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112717
Gene: ENSMUSG00000041440
AA Change: A413S

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:FGGY_N 25 287 1.9e-49 PFAM
Pfam:FGGY_C 296 485 1.8e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129774
SMART Domains Protein: ENSMUSP00000123594
Gene: ENSMUSG00000041440

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
SCOP:d1bu6o1 24 56 1e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189249
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout does not result in an obvious skin phenotype and does not lead to alopecia. [provided by MGI curators]
Allele List at MGI

All alleles(19) : Targeted(2) Gene trapped(17)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 T C 5: 121,600,020 T435A probably benign Het
Adcy3 T A 12: 4,134,438 I38N probably damaging Het
Aff1 A G 5: 103,754,657 probably benign Het
Asxl1 A G 2: 153,401,121 E1197G probably damaging Het
Brinp3 T A 1: 146,901,367 N517K probably damaging Het
Carmil1 C T 13: 24,154,983 probably null Het
Ccdc185 G A 1: 182,748,999 Q42* probably null Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdh10 A G 15: 19,013,360 E682G probably damaging Het
Col6a3 C A 1: 90,810,608 R456L probably damaging Het
Egf C T 3: 129,735,840 R307H probably benign Het
Flt4 T C 11: 49,633,257 probably null Het
Fstl5 A C 3: 76,628,960 K26Q possibly damaging Het
Glcci1 T A 6: 8,537,854 S157R probably benign Het
Gzmc G A 14: 56,233,976 A36V probably damaging Het
Hexb T C 13: 97,182,004 N283S probably benign Het
Hydin A G 8: 110,523,142 E2239G possibly damaging Het
Igkv10-95 A T 6: 68,680,560 Y20F probably benign Het
Il17re A G 6: 113,462,962 T181A probably benign Het
Kcnh6 G A 11: 106,020,319 A514T possibly damaging Het
Kcnk10 G A 12: 98,434,995 R460W probably damaging Het
Krtap5-2 A T 7: 142,174,984 S320T unknown Het
Larp1b G T 3: 40,964,052 E24* probably null Het
Mettl22 A G 16: 8,478,251 T135A probably benign Het
Mlh1 A G 9: 111,241,513 V378A probably benign Het
Mmrn1 A T 6: 60,976,490 H585L probably benign Het
Myh14 A G 7: 44,628,855 F1024L probably damaging Het
Nbea A T 3: 56,019,453 H776Q probably damaging Het
Nod2 A G 8: 88,664,247 D372G possibly damaging Het
Nptn C T 9: 58,618,980 R137* probably null Het
Olfr825 T C 10: 130,162,561 Y255C possibly damaging Het
Pm20d2 C T 4: 33,181,803 V267I probably benign Het
Rassf10 A G 7: 112,954,420 D76G probably benign Het
Rbbp5 A G 1: 132,490,565 T41A possibly damaging Het
Rttn T C 18: 89,013,094 V643A possibly damaging Het
Sbno2 C A 10: 80,066,928 E421* probably null Het
Slc17a3 T C 13: 23,842,542 probably null Het
Slc1a6 T A 10: 78,796,269 probably null Het
Slco2b1 A G 7: 99,689,013 S106P possibly damaging Het
Spef1 T C 2: 131,174,591 N28S probably damaging Het
Srebf2 C A 15: 82,185,402 T675N probably damaging Het
Srp68 C A 11: 116,265,474 E147D probably damaging Het
Tbcd T A 11: 121,609,390 L1114H possibly damaging Het
Tex15 T C 8: 33,576,392 V1950A probably benign Het
Tnfsf9 T A 17: 57,106,263 F148Y possibly damaging Het
Traf6 A G 2: 101,690,057 D150G probably benign Het
Ttn A G 2: 76,863,373 Y262H possibly damaging Het
Unc93b1 A G 19: 3,944,027 Y386C probably damaging Het
Vmn1r226 A T 17: 20,687,863 E119V probably benign Het
Wrn A T 8: 33,352,072 probably null Het
Zfp398 A G 6: 47,865,904 I165V probably benign Het
Zfp850 A T 7: 27,990,356 C142* probably null Het
Other mutations in Gk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Gk5 APN 9 96137789 missense probably damaging 0.98
IGL01387:Gk5 APN 9 96177554 critical splice donor site probably null
IGL01771:Gk5 APN 9 96177435 missense probably damaging 0.97
IGL02253:Gk5 APN 9 96137771 missense probably damaging 1.00
IGL02380:Gk5 APN 9 96150480 missense possibly damaging 0.92
IGL02566:Gk5 APN 9 96129046 missense possibly damaging 0.56
IGL03137:Gk5 APN 9 96176292 splice site probably benign
IGL03256:Gk5 APN 9 96129053 missense probably damaging 1.00
IGL03326:Gk5 APN 9 96137839 critical splice donor site probably null
barrener UTSW 9 96129096 critical splice donor site probably null
glimpse UTSW 9 96181770 critical splice acceptor site probably null
homer UTSW 9 96140656 nonsense probably null
sean UTSW 9 96176237 nonsense probably null
stripped UTSW 9 96129053 missense probably damaging 1.00
tangyuan UTSW 9 96150797 critical splice donor site probably null
toku UTSW 9 96140629 frame shift probably null
I1329:Gk5 UTSW 9 96140629 frame shift probably null
R0279:Gk5 UTSW 9 96174804 splice site probably benign
R0284:Gk5 UTSW 9 96181770 critical splice acceptor site probably null
R1134:Gk5 UTSW 9 96133407 missense probably benign 0.00
R1184:Gk5 UTSW 9 96150420 splice site probably benign
R1772:Gk5 UTSW 9 96150797 critical splice donor site probably null
R1781:Gk5 UTSW 9 96133455 missense possibly damaging 0.79
R3691:Gk5 UTSW 9 96129096 critical splice donor site probably null
R4213:Gk5 UTSW 9 96129053 missense probably damaging 1.00
R5015:Gk5 UTSW 9 96177417 critical splice acceptor site probably null
R5643:Gk5 UTSW 9 96140656 nonsense probably null
R5857:Gk5 UTSW 9 96119455 nonsense probably null
R5924:Gk5 UTSW 9 96150510 critical splice donor site probably null
R6109:Gk5 UTSW 9 96140610 missense probably benign 0.00
R6138:Gk5 UTSW 9 96176237 nonsense probably null
R6725:Gk5 UTSW 9 96155470 missense probably benign 0.01
R6812:Gk5 UTSW 9 96150749 missense probably damaging 0.99
R7065:Gk5 UTSW 9 96179056 missense probably damaging 1.00
R7182:Gk5 UTSW 9 96119526 missense possibly damaging 0.89
R7213:Gk5 UTSW 9 96145712 missense probably damaging 1.00
R7260:Gk5 UTSW 9 96119610 missense probably benign 0.10
U15987:Gk5 UTSW 9 96176237 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAACACGATGGCTGAAGC -3'
(R):5'- TAATCCCTCAAGAGCTAGAGAGAAG -3'

Sequencing Primer
(F):5'- TCTAGACCAGTTGAGGCTACATG -3'
(R):5'- AAGGCTCAGAAGTTAAGAACATATAC -3'
Posted On2016-07-06