Incidental Mutation 'R5166:Fstl5'
ID397289
Institutional Source Beutler Lab
Gene Symbol Fstl5
Ensembl Gene ENSMUSG00000034098
Gene Namefollistatin-like 5
Synonyms9130207J01Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5166 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location76074270-76710019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 76628960 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 26 (K26Q)
Ref Sequence ENSEMBL: ENSMUSP00000125688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038364] [ENSMUST00000160261] [ENSMUST00000162471]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038364
AA Change: K463Q

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038506
Gene: ENSMUSG00000034098
AA Change: K463Q

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
KAZAL 88 133 2.16e-9 SMART
IGc2 261 328 1.11e-5 SMART
IGc2 353 420 3.85e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000160261
AA Change: K463Q

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125393
Gene: ENSMUSG00000034098
AA Change: K463Q

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
KAZAL 88 133 2.16e-9 SMART
IGc2 261 328 1.11e-5 SMART
IGc2 353 420 3.85e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162471
AA Change: K26Q

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 T C 5: 121,600,020 T435A probably benign Het
Adcy3 T A 12: 4,134,438 I38N probably damaging Het
Aff1 A G 5: 103,754,657 probably benign Het
Asxl1 A G 2: 153,401,121 E1197G probably damaging Het
Brinp3 T A 1: 146,901,367 N517K probably damaging Het
Carmil1 C T 13: 24,154,983 probably null Het
Ccdc185 G A 1: 182,748,999 Q42* probably null Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdh10 A G 15: 19,013,360 E682G probably damaging Het
Col6a3 C A 1: 90,810,608 R456L probably damaging Het
Egf C T 3: 129,735,840 R307H probably benign Het
Flt4 T C 11: 49,633,257 probably null Het
Gk5 G T 9: 96,174,768 A413S probably damaging Het
Glcci1 T A 6: 8,537,854 S157R probably benign Het
Gzmc G A 14: 56,233,976 A36V probably damaging Het
Hexb T C 13: 97,182,004 N283S probably benign Het
Hydin A G 8: 110,523,142 E2239G possibly damaging Het
Igkv10-95 A T 6: 68,680,560 Y20F probably benign Het
Il17re A G 6: 113,462,962 T181A probably benign Het
Kcnh6 G A 11: 106,020,319 A514T possibly damaging Het
Kcnk10 G A 12: 98,434,995 R460W probably damaging Het
Krtap5-2 A T 7: 142,174,984 S320T unknown Het
Larp1b G T 3: 40,964,052 E24* probably null Het
Mettl22 A G 16: 8,478,251 T135A probably benign Het
Mlh1 A G 9: 111,241,513 V378A probably benign Het
Mmrn1 A T 6: 60,976,490 H585L probably benign Het
Myh14 A G 7: 44,628,855 F1024L probably damaging Het
Nbea A T 3: 56,019,453 H776Q probably damaging Het
Nod2 A G 8: 88,664,247 D372G possibly damaging Het
Nptn C T 9: 58,618,980 R137* probably null Het
Olfr825 T C 10: 130,162,561 Y255C possibly damaging Het
Pm20d2 C T 4: 33,181,803 V267I probably benign Het
Rassf10 A G 7: 112,954,420 D76G probably benign Het
Rbbp5 A G 1: 132,490,565 T41A possibly damaging Het
Rttn T C 18: 89,013,094 V643A possibly damaging Het
Sbno2 C A 10: 80,066,928 E421* probably null Het
Slc17a3 T C 13: 23,842,542 probably null Het
Slc1a6 T A 10: 78,796,269 probably null Het
Slco2b1 A G 7: 99,689,013 S106P possibly damaging Het
Spef1 T C 2: 131,174,591 N28S probably damaging Het
Srebf2 C A 15: 82,185,402 T675N probably damaging Het
Srp68 C A 11: 116,265,474 E147D probably damaging Het
Tbcd T A 11: 121,609,390 L1114H possibly damaging Het
Tex15 T C 8: 33,576,392 V1950A probably benign Het
Tnfsf9 T A 17: 57,106,263 F148Y possibly damaging Het
Traf6 A G 2: 101,690,057 D150G probably benign Het
Ttn A G 2: 76,863,373 Y262H possibly damaging Het
Unc93b1 A G 19: 3,944,027 Y386C probably damaging Het
Vmn1r226 A T 17: 20,687,863 E119V probably benign Het
Wrn A T 8: 33,352,072 probably null Het
Zfp398 A G 6: 47,865,904 I165V probably benign Het
Zfp850 A T 7: 27,990,356 C142* probably null Het
Other mutations in Fstl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01632:Fstl5 APN 3 76707828 missense probably benign 0.30
IGL01658:Fstl5 APN 3 76482255 missense possibly damaging 0.70
IGL01917:Fstl5 APN 3 76707846 missense probably damaging 1.00
IGL02073:Fstl5 APN 3 76659652 splice site probably benign
IGL02329:Fstl5 APN 3 76588995 missense probably damaging 1.00
IGL02651:Fstl5 APN 3 76593534 missense probably damaging 1.00
IGL02967:Fstl5 APN 3 76322191 missense probably damaging 1.00
IGL03004:Fstl5 APN 3 76648431 splice site probably benign
IGL03107:Fstl5 APN 3 76536311 missense probably damaging 1.00
IGL03113:Fstl5 APN 3 76429792 nonsense probably null
P0038:Fstl5 UTSW 3 76145062 missense probably damaging 1.00
PIT4131001:Fstl5 UTSW 3 76659699 missense probably damaging 0.99
R0015:Fstl5 UTSW 3 76322191 missense probably damaging 1.00
R0015:Fstl5 UTSW 3 76322191 missense probably damaging 1.00
R0032:Fstl5 UTSW 3 76648435 splice site probably benign
R0032:Fstl5 UTSW 3 76648435 splice site probably benign
R0078:Fstl5 UTSW 3 76659645 splice site probably benign
R0137:Fstl5 UTSW 3 76707479 missense probably damaging 1.00
R0183:Fstl5 UTSW 3 76322272 missense possibly damaging 0.86
R0330:Fstl5 UTSW 3 76707753 missense possibly damaging 0.80
R0427:Fstl5 UTSW 3 76707727 nonsense probably null
R0687:Fstl5 UTSW 3 76707812 missense possibly damaging 0.62
R1642:Fstl5 UTSW 3 76410622 missense possibly damaging 0.80
R1765:Fstl5 UTSW 3 76593476 missense possibly damaging 0.90
R1900:Fstl5 UTSW 3 76708160 missense probably damaging 1.00
R1996:Fstl5 UTSW 3 76707834 missense probably benign 0.19
R2157:Fstl5 UTSW 3 76708065 missense possibly damaging 0.46
R2228:Fstl5 UTSW 3 76482352 missense probably damaging 1.00
R2851:Fstl5 UTSW 3 76429738 splice site probably benign
R4021:Fstl5 UTSW 3 76628975 missense probably benign 0.00
R4086:Fstl5 UTSW 3 76648286 missense probably damaging 1.00
R4777:Fstl5 UTSW 3 76593500 missense probably damaging 1.00
R4829:Fstl5 UTSW 3 76322182 missense probably damaging 1.00
R4934:Fstl5 UTSW 3 76588965 missense probably damaging 1.00
R4955:Fstl5 UTSW 3 76223876 critical splice donor site probably null
R4977:Fstl5 UTSW 3 76410494 nonsense probably null
R5232:Fstl5 UTSW 3 76144977 missense possibly damaging 0.89
R5313:Fstl5 UTSW 3 76593505 missense possibly damaging 0.90
R5584:Fstl5 UTSW 3 76322267 missense probably damaging 1.00
R5647:Fstl5 UTSW 3 76589092 missense probably damaging 1.00
R5842:Fstl5 UTSW 3 76322283 missense possibly damaging 0.94
R5978:Fstl5 UTSW 3 76145085 missense probably damaging 1.00
R6007:Fstl5 UTSW 3 76410592 missense probably damaging 1.00
R6064:Fstl5 UTSW 3 76322298 missense probably benign 0.13
R6327:Fstl5 UTSW 3 76707801 missense probably benign 0.31
R6386:Fstl5 UTSW 3 76322066 missense probably benign 0.13
R6523:Fstl5 UTSW 3 76536334 missense probably benign 0.00
R6852:Fstl5 UTSW 3 76707855 missense probably damaging 1.00
R6861:Fstl5 UTSW 3 76322216 missense probably damaging 1.00
R6866:Fstl5 UTSW 3 76322225 missense probably damaging 0.99
R7100:Fstl5 UTSW 3 76536293 missense probably benign 0.11
R7341:Fstl5 UTSW 3 76482397 splice site probably null
R7495:Fstl5 UTSW 3 76707792 missense possibly damaging 0.85
R7558:Fstl5 UTSW 3 76429785 missense possibly damaging 0.95
R7731:Fstl5 UTSW 3 76661762 missense probably damaging 1.00
R7787:Fstl5 UTSW 3 76429824 missense probably damaging 1.00
R7852:Fstl5 UTSW 3 76707968 missense probably benign 0.00
R7874:Fstl5 UTSW 3 76661786 missense probably benign 0.10
R7881:Fstl5 UTSW 3 76536298 missense probably damaging 1.00
R7935:Fstl5 UTSW 3 76707968 missense probably benign 0.00
R7957:Fstl5 UTSW 3 76661786 missense probably benign 0.10
R7964:Fstl5 UTSW 3 76536298 missense probably damaging 1.00
R8039:Fstl5 UTSW 3 76648418 missense possibly damaging 0.69
R8050:Fstl5 UTSW 3 76707503 missense probably benign 0.00
Z1176:Fstl5 UTSW 3 76707982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAAATGTCTCTGTGTGTCTCATG -3'
(R):5'- GCTTCATGAACTCATAGACAGC -3'

Sequencing Primer
(F):5'- TGTCTCATGTAAGGGAGGTCC -3'
(R):5'- ACTTTGAATTCTCTTCCATCACAAG -3'
Posted On2016-07-06