Incidental Mutation 'R5425:Faah'
ID426804
Institutional Source Beutler Lab
Gene Symbol Faah
Ensembl Gene ENSMUSG00000034171
Gene Namefatty acid amide hydrolase
Synonyms
MMRRC Submission 042991-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5425 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location115967145-116017926 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116000796 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 436 (M436K)
Ref Sequence ENSEMBL: ENSMUSP00000041543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049095]
Predicted Effect probably null
Transcript: ENSMUST00000049095
AA Change: M436K

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000041543
Gene: ENSMUSG00000034171
AA Change: M436K

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 74 87 N/A INTRINSIC
Pfam:Amidase 95 562 1.4e-122 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156126
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is responsible for the hydrolysis of a number of primary and secondary fatty acid amides, including the neuromodulatory compounds anandamide and oleamide. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show high brain anandamide (AEA) levels, reduced pain sensation, altered behavioral responses to AEA, and sex-specific changes in ethanol intake and sensitivity. Homozygotes for the C385A variant show enhanced cued fear extinction and reduced anxiety-like behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,537,692 S62G probably damaging Het
Ace A G 11: 105,973,428 E465G probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Aida T A 1: 183,322,346 C174S possibly damaging Het
Aldh1a2 G A 9: 71,253,004 R104H probably benign Het
Aldh3a1 T C 11: 61,213,581 L98P probably benign Het
Ankmy1 G T 1: 92,870,957 Y20* probably null Het
Arhgap9 C A 10: 127,326,418 N314K probably damaging Het
Atxn7l1 T C 12: 33,367,120 Y427H probably damaging Het
Bola3 G T 6: 83,349,552 G18W probably benign Het
Carmil3 A G 14: 55,493,877 T138A probably benign Het
Ccnd2 A G 6: 127,150,617 Y53H probably benign Het
Cd101 T A 3: 101,018,686 D239V probably damaging Het
Ces1g T A 8: 93,325,800 Q287L probably benign Het
Cfap43 C T 19: 47,896,932 A415T possibly damaging Het
Cfap74 A G 4: 155,455,692 probably benign Het
Crnn A G 3: 93,149,149 K414R probably benign Het
Csf1 A G 3: 107,748,896 L273P possibly damaging Het
Dab2ip T G 2: 35,709,991 H206Q probably benign Het
Diras2 A G 13: 52,508,047 S75P probably damaging Het
Dst T C 1: 34,179,750 V1757A probably benign Het
Dus4l A T 12: 31,640,808 H281Q probably damaging Het
Fat1 T C 8: 45,025,885 V2656A possibly damaging Het
Ffar1 A C 7: 30,860,779 L231R probably damaging Het
Gab1 T C 8: 80,800,389 K27E probably damaging Het
Gatsl3 T A 11: 4,221,689 H304Q probably damaging Het
Gm14403 AAACCCTA AA 2: 177,509,655 probably benign Het
Gm8909 A C 17: 36,168,485 L8R probably damaging Het
Irx6 T C 8: 92,677,517 probably null Het
Mcrs1 C A 15: 99,243,688 R376L probably damaging Het
Mrgprb1 T A 7: 48,447,971 L64F possibly damaging Het
Nck2 T G 1: 43,554,392 V253G probably benign Het
Paip1 C T 13: 119,430,166 T12M possibly damaging Het
Pdpk1 A T 17: 24,098,121 L256Q probably damaging Het
Perm1 A G 4: 156,218,295 D432G probably benign Het
Psg25 A T 7: 18,524,784 Y322* probably null Het
Pzp G A 6: 128,489,048 A1223V probably damaging Het
Rassf8 A T 6: 145,815,542 Y198F probably benign Het
Repin1 A G 6: 48,596,431 Q42R probably benign Het
Sirpb1b A C 3: 15,548,669 C51G probably damaging Het
Snx13 C T 12: 35,100,644 Q316* probably null Het
Spesp1 A G 9: 62,282,049 V5A possibly damaging Het
Sprr2e G A 3: 92,353,063 C67Y unknown Het
Tcaf3 G A 6: 42,596,763 P172S probably damaging Het
Tmem126b A G 7: 90,470,947 I72T probably benign Het
Tmem17 G T 11: 22,518,624 V188L probably benign Het
Tnfrsf1b T C 4: 145,229,108 probably null Het
Tshz2 A T 2: 169,884,024 Q180L probably damaging Het
Ttc41 A T 10: 86,776,630 I1256F probably damaging Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Ywhag G T 5: 135,911,265 H158Q probably benign Het
Other mutations in Faah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Faah APN 4 116008283 missense possibly damaging 0.85
IGL03355:Faah APN 4 116002528 missense probably benign 0.28
R0013:Faah UTSW 4 116004391 missense probably damaging 1.00
R0387:Faah UTSW 4 116005692 nonsense probably null
R0727:Faah UTSW 4 116005060 missense probably damaging 1.00
R1405:Faah UTSW 4 116001148 missense probably damaging 1.00
R1405:Faah UTSW 4 116001148 missense probably damaging 1.00
R1465:Faah UTSW 4 115999558 missense probably damaging 1.00
R1465:Faah UTSW 4 115999558 missense probably damaging 1.00
R1861:Faah UTSW 4 116008235 missense probably benign 0.45
R2062:Faah UTSW 4 115998573 missense probably damaging 1.00
R4926:Faah UTSW 4 115999626 intron probably benign
R5162:Faah UTSW 4 116000741 intron probably benign
R5449:Faah UTSW 4 115999495 splice site probably null
R6236:Faah UTSW 4 115999589 missense probably benign 0.03
R6370:Faah UTSW 4 116003056 missense probably damaging 1.00
R6569:Faah UTSW 4 116017632 missense probably benign
R7384:Faah UTSW 4 116005167 missense probably damaging 1.00
X0024:Faah UTSW 4 116002979 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ATATGAAGCTTCAGGGCCCC -3'
(R):5'- ACACTACCTTGTGGTCTCTGG -3'

Sequencing Primer
(F):5'- ACCACGTGAACTCAGACT -3'
(R):5'- GGCAGGCATGGTCTCTTCATC -3'
Posted On2016-09-01