Incidental Mutation 'R5425:Ankmy1'
ID426793
Institutional Source Beutler Lab
Gene Symbol Ankmy1
Ensembl Gene ENSMUSG00000034212
Gene Nameankyrin repeat and MYND domain containing 1
Synonyms4930483I10Rik
MMRRC Submission 042991-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5425 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location92859803-92902906 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 92870957 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 20 (Y20*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112998] [ENSMUST00000160548]
Predicted Effect probably null
Transcript: ENSMUST00000112998
AA Change: Y937*
SMART Domains Protein: ENSMUSP00000108622
Gene: ENSMUSG00000034212
AA Change: Y937*

DomainStartEndE-ValueType
low complexity region 51 68 N/A INTRINSIC
MORN 87 108 4.22e0 SMART
MORN 110 131 7.05e-5 SMART
MORN 155 176 7.15e1 SMART
ANK 378 407 4.32e-5 SMART
Blast:ANK 575 604 2e-10 BLAST
ANK 607 636 2.63e2 SMART
ANK 643 675 1.87e2 SMART
ANK 719 753 1.73e-4 SMART
ANK 756 785 6.92e-4 SMART
Blast:ANK 790 828 1e-12 BLAST
low complexity region 876 889 N/A INTRINSIC
Pfam:zf-MYND 940 980 1.8e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000160548
AA Change: Y938*
SMART Domains Protein: ENSMUSP00000123787
Gene: ENSMUSG00000034212
AA Change: Y938*

DomainStartEndE-ValueType
low complexity region 51 68 N/A INTRINSIC
MORN 87 108 4.22e0 SMART
MORN 110 131 7.05e-5 SMART
MORN 155 176 7.15e1 SMART
ANK 378 407 4.32e-5 SMART
Blast:ANK 575 604 2e-10 BLAST
ANK 607 636 2.63e2 SMART
ANK 643 675 1.87e2 SMART
ANK 719 753 1.73e-4 SMART
ANK 756 785 6.92e-4 SMART
Blast:ANK 790 828 1e-12 BLAST
low complexity region 876 889 N/A INTRINSIC
Pfam:zf-MYND 941 981 2.3e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000212504
AA Change: Y20*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,537,692 S62G probably damaging Het
Ace A G 11: 105,973,428 E465G probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Aida T A 1: 183,322,346 C174S possibly damaging Het
Aldh1a2 G A 9: 71,253,004 R104H probably benign Het
Aldh3a1 T C 11: 61,213,581 L98P probably benign Het
Arhgap9 C A 10: 127,326,418 N314K probably damaging Het
Atxn7l1 T C 12: 33,367,120 Y427H probably damaging Het
Bola3 G T 6: 83,349,552 G18W probably benign Het
Carmil3 A G 14: 55,493,877 T138A probably benign Het
Ccnd2 A G 6: 127,150,617 Y53H probably benign Het
Cd101 T A 3: 101,018,686 D239V probably damaging Het
Ces1g T A 8: 93,325,800 Q287L probably benign Het
Cfap43 C T 19: 47,896,932 A415T possibly damaging Het
Cfap74 A G 4: 155,455,692 probably benign Het
Crnn A G 3: 93,149,149 K414R probably benign Het
Csf1 A G 3: 107,748,896 L273P possibly damaging Het
Dab2ip T G 2: 35,709,991 H206Q probably benign Het
Diras2 A G 13: 52,508,047 S75P probably damaging Het
Dst T C 1: 34,179,750 V1757A probably benign Het
Dus4l A T 12: 31,640,808 H281Q probably damaging Het
Faah A T 4: 116,000,796 M436K probably null Het
Fat1 T C 8: 45,025,885 V2656A possibly damaging Het
Ffar1 A C 7: 30,860,779 L231R probably damaging Het
Gab1 T C 8: 80,800,389 K27E probably damaging Het
Gatsl3 T A 11: 4,221,689 H304Q probably damaging Het
Gm14403 AAACCCTA AA 2: 177,509,655 probably benign Het
Gm8909 A C 17: 36,168,485 L8R probably damaging Het
Irx6 T C 8: 92,677,517 probably null Het
Mcrs1 C A 15: 99,243,688 R376L probably damaging Het
Mrgprb1 T A 7: 48,447,971 L64F possibly damaging Het
Nck2 T G 1: 43,554,392 V253G probably benign Het
Paip1 C T 13: 119,430,166 T12M possibly damaging Het
Pdpk1 A T 17: 24,098,121 L256Q probably damaging Het
Perm1 A G 4: 156,218,295 D432G probably benign Het
Psg25 A T 7: 18,524,784 Y322* probably null Het
Pzp G A 6: 128,489,048 A1223V probably damaging Het
Rassf8 A T 6: 145,815,542 Y198F probably benign Het
Repin1 A G 6: 48,596,431 Q42R probably benign Het
Sirpb1b A C 3: 15,548,669 C51G probably damaging Het
Snx13 C T 12: 35,100,644 Q316* probably null Het
Spesp1 A G 9: 62,282,049 V5A possibly damaging Het
Sprr2e G A 3: 92,353,063 C67Y unknown Het
Tcaf3 G A 6: 42,596,763 P172S probably damaging Het
Tmem126b A G 7: 90,470,947 I72T probably benign Het
Tmem17 G T 11: 22,518,624 V188L probably benign Het
Tnfrsf1b T C 4: 145,229,108 probably null Het
Tshz2 A T 2: 169,884,024 Q180L probably damaging Het
Ttc41 A T 10: 86,776,630 I1256F probably damaging Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Ywhag G T 5: 135,911,265 H158Q probably benign Het
Other mutations in Ankmy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Ankmy1 APN 1 92886266 missense probably damaging 1.00
IGL01061:Ankmy1 APN 1 92870974 splice site probably benign
IGL01960:Ankmy1 APN 1 92871663 splice site probably benign
IGL01984:Ankmy1 APN 1 92883765 missense probably damaging 0.99
IGL02193:Ankmy1 APN 1 92881045 missense probably benign 0.03
IGL02536:Ankmy1 APN 1 92886188 missense probably damaging 1.00
IGL02644:Ankmy1 APN 1 92885054 missense probably benign 0.18
IGL02650:Ankmy1 APN 1 92881023 missense probably damaging 1.00
IGL02660:Ankmy1 APN 1 92896094 missense probably damaging 1.00
IGL02808:Ankmy1 APN 1 92886666 missense probably damaging 1.00
PIT4687001:Ankmy1 UTSW 1 92885081 missense probably benign 0.00
R0313:Ankmy1 UTSW 1 92886221 missense probably damaging 1.00
R0373:Ankmy1 UTSW 1 92896190 missense probably damaging 0.99
R0383:Ankmy1 UTSW 1 92885053 missense probably benign 0.00
R0499:Ankmy1 UTSW 1 92886226 missense probably damaging 1.00
R0562:Ankmy1 UTSW 1 92899691 splice site probably benign
R0607:Ankmy1 UTSW 1 92888675 missense probably damaging 1.00
R0739:Ankmy1 UTSW 1 92888648 missense probably damaging 1.00
R0962:Ankmy1 UTSW 1 92899568 nonsense probably null
R1192:Ankmy1 UTSW 1 92883894 missense probably damaging 0.99
R1491:Ankmy1 UTSW 1 92886809 missense probably benign 0.02
R1568:Ankmy1 UTSW 1 92881116 missense probably damaging 1.00
R1585:Ankmy1 UTSW 1 92899651 missense probably benign 0.00
R1590:Ankmy1 UTSW 1 92888675 missense probably damaging 1.00
R1664:Ankmy1 UTSW 1 92885191 missense probably benign 0.00
R1714:Ankmy1 UTSW 1 92885194 nonsense probably null
R1818:Ankmy1 UTSW 1 92886831 missense probably benign 0.43
R2014:Ankmy1 UTSW 1 92885141 missense probably benign 0.00
R2043:Ankmy1 UTSW 1 92876527 unclassified probably benign
R2056:Ankmy1 UTSW 1 92881831 missense possibly damaging 0.61
R2427:Ankmy1 UTSW 1 92870807 critical splice donor site probably null
R3806:Ankmy1 UTSW 1 92883758 missense possibly damaging 0.92
R3883:Ankmy1 UTSW 1 92886152 missense probably damaging 1.00
R3884:Ankmy1 UTSW 1 92886152 missense probably damaging 1.00
R4118:Ankmy1 UTSW 1 92888696 missense possibly damaging 0.60
R4132:Ankmy1 UTSW 1 92885100 missense probably benign
R4441:Ankmy1 UTSW 1 92888661 missense possibly damaging 0.92
R4543:Ankmy1 UTSW 1 92884850 missense probably damaging 1.00
R4602:Ankmy1 UTSW 1 92888650 missense probably benign 0.38
R4779:Ankmy1 UTSW 1 92886723 missense probably benign 0.23
R5200:Ankmy1 UTSW 1 92870292 missense probably benign 0.00
R5381:Ankmy1 UTSW 1 92876562 missense probably benign
R5474:Ankmy1 UTSW 1 92885204 missense possibly damaging 0.59
R5534:Ankmy1 UTSW 1 92886720 missense probably damaging 1.00
R5607:Ankmy1 UTSW 1 92877018 missense probably damaging 1.00
R6112:Ankmy1 UTSW 1 92870962 missense probably damaging 1.00
R6117:Ankmy1 UTSW 1 92861274 unclassified probably benign
R6376:Ankmy1 UTSW 1 92888465 missense possibly damaging 0.60
R6712:Ankmy1 UTSW 1 92870922 missense probably damaging 1.00
R6915:Ankmy1 UTSW 1 92888451 missense probably null 1.00
R7201:Ankmy1 UTSW 1 92886824 missense possibly damaging 0.95
R7432:Ankmy1 UTSW 1 92896079 missense probably benign
R7485:Ankmy1 UTSW 1 92876657 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGCACTGTGTCTTTGTTCTAG -3'
(R):5'- CCAAAGGCTCAGTGTGCATC -3'

Sequencing Primer
(F):5'- TTCTAGGAAGCAGTAGGGCCC -3'
(R):5'- AGGCTCAGTGTGCATCAACTG -3'
Posted On2016-09-01