Incidental Mutation 'R5449:Wee1'
ID429226
Institutional Source Beutler Lab
Gene Symbol Wee1
Ensembl Gene ENSMUSG00000031016
Gene NameWEE 1 homolog 1 (S. pombe)
SynonymsWee1A
MMRRC Submission 043014-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5449 (G1)
Quality Score163
Status Not validated
Chromosome7
Chromosomal Location110122046-110143286 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TCCCC to TCCC at 110124569 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033326]
Predicted Effect probably null
Transcript: ENSMUST00000033326
SMART Domains Protein: ENSMUSP00000033326
Gene: ENSMUSG00000031016

DomainStartEndE-ValueType
low complexity region 62 112 N/A INTRINSIC
Pfam:Pkinase_Tyr 298 566 1.9e-26 PFAM
Pfam:Pkinase 298 568 1.7e-61 PFAM
low complexity region 620 631 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210940
Meta Mutation Damage Score 0.5688 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein, which is a tyrosine kinase belonging to the Ser/Thr family of protein kinases. This protein catalyzes the inhibitory tyrosine phosphorylation of CDC2/cyclin B kinase, and appears to coordinate the transition between DNA replication and mitosis by protecting the nucleus from cytoplasmically activated CDC2 kinase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit embryonic lethality at E7. Mice homozygous for a knock-out allele exhibit lethality between E3.5 and E7.5 with reduced proliferation, increased apoptosis and abnormal G2/M checkpoint function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik G A 19: 5,503,264 T163M probably benign Het
4921539E11Rik T A 4: 103,266,382 I98F probably benign Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
A630010A05Rik A G 16: 14,618,673 K197E possibly damaging Het
Agrn A G 4: 156,167,280 probably null Het
Atad5 A G 11: 80,124,108 I1337V probably damaging Het
Cd44 T C 2: 102,832,546 T550A probably damaging Het
Cdk5rap2 A C 4: 70,276,651 L952V probably benign Het
Cep104 T A 4: 153,985,305 probably null Het
Cfl1 A G 19: 5,493,493 *167W probably null Het
Col22a1 T C 15: 71,821,949 D734G unknown Het
Cry1 G A 10: 85,133,135 L581F probably benign Het
Dmpk A G 7: 19,090,991 D406G probably benign Het
Faah T C 4: 115,999,495 probably null Het
Fchsd2 T C 7: 101,277,524 F607S probably damaging Het
Fga CAAAG CAAAGAAAG 3: 83,030,862 probably null Het
Hdac5 G A 11: 102,196,097 Q46* probably null Het
Hltf A G 3: 20,069,083 T212A possibly damaging Het
Ilvbl G A 10: 78,577,028 probably null Het
Ldhc T C 7: 46,869,658 S102P possibly damaging Het
Med12l T C 3: 59,259,706 V1529A probably damaging Het
Nlrp9a A G 7: 26,557,829 I202V probably benign Het
Pdc A C 1: 150,333,439 L224F probably damaging Het
Pgr T C 9: 8,956,343 V764A possibly damaging Het
Plxna1 T C 6: 89,323,608 D1578G probably damaging Het
Prpf40a G T 2: 53,156,926 T266N possibly damaging Het
Ptrh1 A G 2: 32,776,346 S37G probably damaging Het
Rgs9 T C 11: 109,225,744 D411G probably benign Het
Riok3 A T 18: 12,155,246 E493D probably damaging Het
Rnf213 T C 11: 119,415,076 M570T probably benign Het
Scamp2 A G 9: 57,580,871 D187G probably damaging Het
Scn1a T A 2: 66,321,002 I819F probably damaging Het
Slc7a5 C A 8: 121,886,348 W330C probably damaging Het
Syn3 A T 10: 86,351,570 F230Y probably damaging Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Tro T C X: 150,645,970 probably benign Het
Ubr1 T A 2: 120,963,500 M68L probably benign Het
Vmn1r120 A C 7: 21,053,149 H212Q possibly damaging Het
Vmn1r46 T C 6: 89,976,361 V64A probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Zfp384 T C 6: 125,024,138 S58P probably damaging Het
Other mutations in Wee1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Wee1 APN 7 110134853 splice site probably null
IGL00981:Wee1 APN 7 110139669 missense probably damaging 1.00
IGL01017:Wee1 APN 7 110125848 missense possibly damaging 0.93
IGL01357:Wee1 APN 7 110142035 missense probably benign 0.39
IGL01838:Wee1 APN 7 110124537 missense probably benign 0.01
IGL01970:Wee1 APN 7 110139250 missense probably damaging 1.00
IGL02396:Wee1 APN 7 110142093 missense probably damaging 1.00
IGL02511:Wee1 APN 7 110139276 missense possibly damaging 0.55
IGL02884:Wee1 APN 7 110126062 missense probably benign 0.02
IGL03085:Wee1 APN 7 110124598 missense probably damaging 1.00
IGL03221:Wee1 APN 7 110126817 missense probably damaging 1.00
IGL03383:Wee1 APN 7 110139692 missense probably damaging 1.00
R0220:Wee1 UTSW 7 110124526 missense probably benign 0.10
R1934:Wee1 UTSW 7 110122491 missense probably benign 0.06
R3110:Wee1 UTSW 7 110130836 missense probably damaging 1.00
R3112:Wee1 UTSW 7 110130836 missense probably damaging 1.00
R3978:Wee1 UTSW 7 110124555 missense probably damaging 1.00
R4348:Wee1 UTSW 7 110130958 missense probably damaging 1.00
R5434:Wee1 UTSW 7 110124569 frame shift probably null
R5435:Wee1 UTSW 7 110124569 frame shift probably null
R5436:Wee1 UTSW 7 110124569 frame shift probably null
R5566:Wee1 UTSW 7 110126050 nonsense probably null
R5630:Wee1 UTSW 7 110124569 frame shift probably null
R5632:Wee1 UTSW 7 110124569 frame shift probably null
R5685:Wee1 UTSW 7 110124569 frame shift probably null
R5694:Wee1 UTSW 7 110124569 frame shift probably null
R5807:Wee1 UTSW 7 110124569 frame shift probably null
R5941:Wee1 UTSW 7 110124569 frame shift probably null
R6044:Wee1 UTSW 7 110139306 missense probably benign 0.00
R6163:Wee1 UTSW 7 110135651 missense probably damaging 1.00
R6826:Wee1 UTSW 7 110124663 critical splice donor site probably null
R7203:Wee1 UTSW 7 110134794 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCACTTAGGAAGGCAAGTTG -3'
(R):5'- TGAAGACATTCATGCCATTCAGTAG -3'

Sequencing Primer
(F):5'- GTTGGAGGTTATATAGAGAAGACTCC -3'
(R):5'- AACCTAATTGTGTGCCAGGC -3'
Posted On2016-09-06