Incidental Mutation 'R5449:Plxna1'
ID429217
Institutional Source Beutler Lab
Gene Symbol Plxna1
Ensembl Gene ENSMUSG00000030084
Gene Nameplexin A1
SynonymsNOV, Plxn1, PlexA1, 2600013D04Rik
MMRRC Submission 043014-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.804) question?
Stock #R5449 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location89316314-89362620 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89323608 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1578 (D1578G)
Ref Sequence ENSEMBL: ENSMUSP00000131840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049845] [ENSMUST00000163139]
Predicted Effect probably damaging
Transcript: ENSMUST00000049845
AA Change: D1578G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063066
Gene: ENSMUSG00000030084
AA Change: D1578G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1316 1864 8.8e-263 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163139
AA Change: D1578G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131840
Gene: ENSMUSG00000030084
AA Change: D1578G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1315 1864 2.5e-264 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181258
Predicted Effect probably benign
Transcript: ENSMUST00000204468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205230
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit bone cellularity abnormalities, altered dendritic cell physiology, abnormal proprioceptive and oligodendrocyte morphology, and increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik G A 19: 5,503,264 T163M probably benign Het
4921539E11Rik T A 4: 103,266,382 I98F probably benign Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
A630010A05Rik A G 16: 14,618,673 K197E possibly damaging Het
Agrn A G 4: 156,167,280 probably null Het
Atad5 A G 11: 80,124,108 I1337V probably damaging Het
Cd44 T C 2: 102,832,546 T550A probably damaging Het
Cdk5rap2 A C 4: 70,276,651 L952V probably benign Het
Cep104 T A 4: 153,985,305 probably null Het
Cfl1 A G 19: 5,493,493 *167W probably null Het
Col22a1 T C 15: 71,821,949 D734G unknown Het
Cry1 G A 10: 85,133,135 L581F probably benign Het
Dmpk A G 7: 19,090,991 D406G probably benign Het
Faah T C 4: 115,999,495 probably null Het
Fchsd2 T C 7: 101,277,524 F607S probably damaging Het
Fga CAAAG CAAAGAAAG 3: 83,030,862 probably null Het
Hdac5 G A 11: 102,196,097 Q46* probably null Het
Hltf A G 3: 20,069,083 T212A possibly damaging Het
Ilvbl G A 10: 78,577,028 probably null Het
Ldhc T C 7: 46,869,658 S102P possibly damaging Het
Med12l T C 3: 59,259,706 V1529A probably damaging Het
Nlrp9a A G 7: 26,557,829 I202V probably benign Het
Pdc A C 1: 150,333,439 L224F probably damaging Het
Pgr T C 9: 8,956,343 V764A possibly damaging Het
Prpf40a G T 2: 53,156,926 T266N possibly damaging Het
Ptrh1 A G 2: 32,776,346 S37G probably damaging Het
Rgs9 T C 11: 109,225,744 D411G probably benign Het
Riok3 A T 18: 12,155,246 E493D probably damaging Het
Rnf213 T C 11: 119,415,076 M570T probably benign Het
Scamp2 A G 9: 57,580,871 D187G probably damaging Het
Scn1a T A 2: 66,321,002 I819F probably damaging Het
Slc7a5 C A 8: 121,886,348 W330C probably damaging Het
Syn3 A T 10: 86,351,570 F230Y probably damaging Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Tro T C X: 150,645,970 probably benign Het
Ubr1 T A 2: 120,963,500 M68L probably benign Het
Vmn1r120 A C 7: 21,053,149 H212Q possibly damaging Het
Vmn1r46 T C 6: 89,976,361 V64A probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp384 T C 6: 125,024,138 S58P probably damaging Het
Other mutations in Plxna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Plxna1 APN 6 89320998 missense probably damaging 1.00
IGL01358:Plxna1 APN 6 89322750 missense probably damaging 1.00
IGL01475:Plxna1 APN 6 89354888 missense possibly damaging 0.92
IGL01480:Plxna1 APN 6 89344096 missense possibly damaging 0.70
IGL01585:Plxna1 APN 6 89329556 critical splice donor site probably null
IGL01804:Plxna1 APN 6 89329646 missense probably damaging 1.00
IGL01909:Plxna1 APN 6 89332084 critical splice donor site probably null
IGL01989:Plxna1 APN 6 89329414 nonsense probably null
IGL02015:Plxna1 APN 6 89342451 missense probably damaging 1.00
IGL02023:Plxna1 APN 6 89357332 missense possibly damaging 0.88
IGL02668:Plxna1 APN 6 89357269 nonsense probably null
IGL02703:Plxna1 APN 6 89356943 missense probably damaging 1.00
IGL02954:Plxna1 APN 6 89324667 missense probably damaging 1.00
IGL03212:Plxna1 APN 6 89331903 missense probably damaging 1.00
PIT4544001:Plxna1 UTSW 6 89357429 missense probably benign 0.14
R0055:Plxna1 UTSW 6 89329739 missense possibly damaging 0.94
R0055:Plxna1 UTSW 6 89329739 missense possibly damaging 0.94
R0147:Plxna1 UTSW 6 89320710 missense possibly damaging 0.95
R0149:Plxna1 UTSW 6 89320613 missense probably null 0.95
R0166:Plxna1 UTSW 6 89333019 missense probably damaging 1.00
R0200:Plxna1 UTSW 6 89323593 missense probably damaging 1.00
R0415:Plxna1 UTSW 6 89357336 missense probably benign 0.12
R0841:Plxna1 UTSW 6 89332204 missense probably damaging 1.00
R1018:Plxna1 UTSW 6 89342960 missense probably damaging 1.00
R1240:Plxna1 UTSW 6 89321050 missense probably damaging 1.00
R1355:Plxna1 UTSW 6 89320766 unclassified probably benign
R1700:Plxna1 UTSW 6 89357008 missense probably damaging 1.00
R1776:Plxna1 UTSW 6 89335464 missense probably benign 0.00
R1957:Plxna1 UTSW 6 89331291 missense probably damaging 1.00
R2314:Plxna1 UTSW 6 89324316 missense probably damaging 1.00
R2968:Plxna1 UTSW 6 89342608 missense probably damaging 1.00
R3118:Plxna1 UTSW 6 89356976 missense possibly damaging 0.89
R3522:Plxna1 UTSW 6 89337353 critical splice acceptor site probably null
R3619:Plxna1 UTSW 6 89357453 missense probably damaging 0.97
R3766:Plxna1 UTSW 6 89334775 unclassified probably benign
R3847:Plxna1 UTSW 6 89356519 missense probably damaging 1.00
R3849:Plxna1 UTSW 6 89356519 missense probably damaging 1.00
R3872:Plxna1 UTSW 6 89332692 nonsense probably null
R4555:Plxna1 UTSW 6 89323328 missense probably damaging 0.99
R4709:Plxna1 UTSW 6 89334751 missense possibly damaging 0.72
R4726:Plxna1 UTSW 6 89322816 missense probably damaging 1.00
R4739:Plxna1 UTSW 6 89332675 splice site probably null
R5053:Plxna1 UTSW 6 89322460 missense probably damaging 1.00
R5221:Plxna1 UTSW 6 89321016 missense probably damaging 1.00
R5480:Plxna1 UTSW 6 89324634 missense probably damaging 1.00
R5575:Plxna1 UTSW 6 89324541 missense possibly damaging 0.83
R5743:Plxna1 UTSW 6 89356529 missense probably damaging 1.00
R5744:Plxna1 UTSW 6 89334682 missense possibly damaging 0.67
R5754:Plxna1 UTSW 6 89333105 missense possibly damaging 0.96
R5868:Plxna1 UTSW 6 89322722 splice site probably benign
R5988:Plxna1 UTSW 6 89357540 nonsense probably null
R6190:Plxna1 UTSW 6 89356604 nonsense probably null
R6425:Plxna1 UTSW 6 89334665 missense probably benign 0.00
R6561:Plxna1 UTSW 6 89356978 missense probably damaging 1.00
R6623:Plxna1 UTSW 6 89322771 missense probably damaging 1.00
R6638:Plxna1 UTSW 6 89324400 missense probably damaging 0.97
R6701:Plxna1 UTSW 6 89319448 missense probably damaging 0.99
R6825:Plxna1 UTSW 6 89320615 missense probably benign 0.01
R6911:Plxna1 UTSW 6 89320974 missense probably damaging 1.00
R7073:Plxna1 UTSW 6 89357329 missense probably damaging 1.00
R7177:Plxna1 UTSW 6 89323329 missense possibly damaging 0.50
R7235:Plxna1 UTSW 6 89340591 missense probably damaging 0.97
R7419:Plxna1 UTSW 6 89357602 missense unknown
R7511:Plxna1 UTSW 6 89341907 missense possibly damaging 0.71
R7543:Plxna1 UTSW 6 89322855 missense probably damaging 1.00
R7665:Plxna1 UTSW 6 89324538 critical splice donor site probably null
R7678:Plxna1 UTSW 6 89331900 missense probably damaging 0.99
S24628:Plxna1 UTSW 6 89357336 missense probably benign 0.12
V8831:Plxna1 UTSW 6 89357137 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGCCACCACTCTGAATCTC -3'
(R):5'- TTCCTCAAGTGCAGAGCAAGC -3'

Sequencing Primer
(F):5'- ACTCTGAATCTCCACTGGGATGG -3'
(R):5'- AGTGCAGAGCAAGCCCCTC -3'
Posted On2016-09-06