Incidental Mutation 'R5521:Mamdc2'
ID431585
Institutional Source Beutler Lab
Gene Symbol Mamdc2
Ensembl Gene ENSMUSG00000033207
Gene NameMAM domain containing 2
Synonyms1200015L10Rik, mamcan
MMRRC Submission 043080-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R5521 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location23302609-23448322 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 23310938 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 579 (G579W)
Ref Sequence ENSEMBL: ENSMUSP00000045432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036069]
Predicted Effect probably damaging
Transcript: ENSMUST00000036069
AA Change: G579W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045432
Gene: ENSMUSG00000033207
AA Change: G579W

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 21 169 3.15e-12 SMART
MAM 170 329 9.26e-42 SMART
MAM 337 498 1.07e-32 SMART
MAM 504 666 3.55e-61 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.5%
  • 10x: 94.4%
  • 20x: 87.5%
Validation Efficiency 94% (72/77)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 A G 9: 44,279,683 probably benign Het
Abhd14a G T 9: 106,443,834 D107E probably damaging Het
Acat1 T A 9: 53,583,507 K362* probably null Het
Adad2 T A 8: 119,612,789 S3R probably benign Het
Adcy8 C A 15: 64,815,350 R435M probably damaging Het
Adgrv1 A T 13: 81,419,389 S5222T probably benign Het
Ankk1 A T 9: 49,420,448 M182K probably benign Het
Apba1 C T 19: 23,893,593 P263L probably damaging Het
Arhgap39 G A 15: 76,765,494 S26L possibly damaging Het
Ccng1 G A 11: 40,752,266 T118I possibly damaging Het
Cenpe T C 3: 135,269,065 S2329P probably damaging Het
Chil4 A G 3: 106,203,697 Y294H possibly damaging Het
Chst8 A C 7: 34,675,245 S390A probably benign Het
Dars T C 1: 128,373,973 D308G probably benign Het
Dlec1 A C 9: 119,143,401 Q1458P possibly damaging Het
Dvl2 G A 11: 70,006,407 E312K probably damaging Het
Fchsd1 T C 18: 37,966,484 H219R probably damaging Het
Foxd4 A C 19: 24,899,643 C398G probably damaging Het
Gm10719 T A 9: 3,018,970 F72I probably damaging Het
Gm5414 T C 15: 101,627,987 I68V probably benign Het
Gmip C T 8: 69,817,399 T684I probably damaging Het
Gpr137c T C 14: 45,278,694 I295T possibly damaging Het
Hivep1 T A 13: 42,158,328 M1348K probably damaging Het
Igkv6-23 T C 6: 70,260,613 D48G probably benign Het
Il3 G A 11: 54,267,132 T40M possibly damaging Het
Ing2 T C 8: 47,669,213 E100G probably damaging Het
Itpr3 C A 17: 27,107,334 H1359Q probably benign Het
Lama1 T A 17: 67,780,894 Y1502* probably null Het
Mapk6 G A 9: 75,393,316 probably benign Het
Mapk8ip2 C T 15: 89,458,804 R616W probably damaging Het
Mc5r T A 18: 68,339,677 L369H possibly damaging Het
Meis1 T C 11: 18,988,260 probably benign Het
Mmp8 A G 9: 7,560,643 K107R probably benign Het
Mn1 C T 5: 111,421,769 H1202Y possibly damaging Het
Naip2 A G 13: 100,154,914 L1172P probably damaging Het
Nek9 C T 12: 85,327,445 D273N probably benign Het
Nlrp4e A T 7: 23,321,765 D559V probably benign Het
Nlrp4g T C 9: 124,350,020 noncoding transcript Het
Oit3 G T 10: 59,435,914 A207E probably benign Het
Olfr1140 A G 2: 87,747,062 I289V probably benign Het
Olfr298 A T 7: 86,488,631 C307S probably benign Het
Olfr462 A T 11: 87,889,719 M59K probably damaging Het
Olfr71 A T 4: 43,705,788 M260K possibly damaging Het
Pde4c T C 8: 70,747,382 probably null Het
Ppp1r26 A G 2: 28,451,426 E356G probably benign Het
Pramef12 A G 4: 144,395,971 M1T probably null Het
Ptges3-ps T A 6: 85,844,321 noncoding transcript Het
Ptpn13 T G 5: 103,501,428 F232L probably benign Het
Reps1 T C 10: 18,104,234 S114P probably damaging Het
Scarf2 T A 16: 17,803,602 probably null Het
Sdha A T 13: 74,350,099 probably benign Het
Secisbp2l A T 2: 125,752,977 V146D possibly damaging Het
Slc26a8 T A 17: 28,654,859 T385S probably benign Het
Slc4a1 G A 11: 102,353,266 T679M probably benign Het
Tbc1d14 T A 5: 36,520,552 E353V probably damaging Het
Thap2 T A 10: 115,372,760 K152* probably null Het
Thbd A T 2: 148,407,735 I71N probably damaging Het
V1ra8 T A 6: 90,203,054 W80R probably damaging Het
Vmn1r218 A G 13: 23,136,573 Y30C probably benign Het
Vmn2r60 C A 7: 42,195,625 T804K probably damaging Het
Vmn2r68 A T 7: 85,233,718 D275E probably benign Het
Vps13c A G 9: 67,951,439 I2724V probably benign Het
Xrcc5 C A 1: 72,346,271 P507Q probably damaging Het
Zfp120 A T 2: 150,117,579 Y274* probably null Het
Zfp780b C A 7: 27,974,748 probably null Het
Other mutations in Mamdc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Mamdc2 APN 19 23378774 nonsense probably null
IGL00588:Mamdc2 APN 19 23353316 missense possibly damaging 0.89
IGL01105:Mamdc2 APN 19 23331002 missense probably benign 0.36
IGL02223:Mamdc2 APN 19 23359143 splice site probably benign
IGL02511:Mamdc2 APN 19 23378731 missense probably benign 0.00
IGL02632:Mamdc2 APN 19 23330976 missense probably benign 0.03
IGL02832:Mamdc2 APN 19 23303851 missense probably damaging 0.99
R0071:Mamdc2 UTSW 19 23303630 nonsense probably null
R0121:Mamdc2 UTSW 19 23310859 missense probably benign 0.01
R0732:Mamdc2 UTSW 19 23378869 missense probably damaging 0.98
R1023:Mamdc2 UTSW 19 23310907 missense probably damaging 1.00
R1860:Mamdc2 UTSW 19 23359153 missense probably damaging 0.98
R1861:Mamdc2 UTSW 19 23359153 missense probably damaging 0.98
R1996:Mamdc2 UTSW 19 23363925 nonsense probably null
R2012:Mamdc2 UTSW 19 23310851 missense probably benign 0.00
R2016:Mamdc2 UTSW 19 23334029 missense probably damaging 0.98
R2266:Mamdc2 UTSW 19 23303903 splice site probably benign
R2267:Mamdc2 UTSW 19 23303903 splice site probably benign
R2269:Mamdc2 UTSW 19 23303903 splice site probably benign
R3085:Mamdc2 UTSW 19 23310932 missense possibly damaging 0.80
R4235:Mamdc2 UTSW 19 23374017 missense possibly damaging 0.94
R4672:Mamdc2 UTSW 19 23350784 missense probably damaging 1.00
R5074:Mamdc2 UTSW 19 23378796 missense probably benign 0.01
R5084:Mamdc2 UTSW 19 23359152 missense possibly damaging 0.95
R6119:Mamdc2 UTSW 19 23353315 missense probably damaging 1.00
R6334:Mamdc2 UTSW 19 23363906 missense probably damaging 1.00
R6557:Mamdc2 UTSW 19 23310845 missense possibly damaging 0.80
R6676:Mamdc2 UTSW 19 23303633 missense probably damaging 1.00
R7218:Mamdc2 UTSW 19 23447610 missense probably benign 0.00
R7616:Mamdc2 UTSW 19 23350804 missense probably damaging 1.00
R7627:Mamdc2 UTSW 19 23310991 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTTAAGCAAACAACAGGAGAGCAC -3'
(R):5'- AGTGGCTATGTTTCCAGGAATTC -3'

Sequencing Primer
(F):5'- CCTCGTGGCTTACCTGGTG -3'
(R):5'- CCCACATGGTGTATGGAC -3'
Posted On2016-10-05