Incidental Mutation 'R1023:Mamdc2'
ID94678
Institutional Source Beutler Lab
Gene Symbol Mamdc2
Ensembl Gene ENSMUSG00000033207
Gene NameMAM domain containing 2
Synonyms1200015L10Rik, mamcan
MMRRC Submission 039125-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R1023 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location23302609-23448322 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23310907 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 589 (M589K)
Ref Sequence ENSEMBL: ENSMUSP00000045432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036069]
Predicted Effect probably damaging
Transcript: ENSMUST00000036069
AA Change: M589K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045432
Gene: ENSMUSG00000033207
AA Change: M589K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 21 169 3.15e-12 SMART
MAM 170 329 9.26e-42 SMART
MAM 337 498 1.07e-32 SMART
MAM 504 666 3.55e-61 SMART
Meta Mutation Damage Score 0.9318 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,066,871 A607V probably damaging Het
4930523C07Rik A G 1: 160,077,487 probably benign Het
Ap3d1 A T 10: 80,714,258 L713Q probably damaging Het
Baz2a A G 10: 128,121,807 T1010A possibly damaging Het
Cd163l1 T A 7: 140,224,463 C484S possibly damaging Het
Cdh15 T C 8: 122,865,200 I608T probably damaging Het
Cdkl2 A T 5: 92,039,286 D40E possibly damaging Het
Col9a2 G A 4: 121,044,010 G118R unknown Het
Cryge C A 1: 65,050,786 C79F probably damaging Het
Dapk1 T C 13: 60,730,985 L596P probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Enam A G 5: 88,501,967 Q445R probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gnpat A T 8: 124,870,780 D27V probably benign Het
Htr5a A T 5: 27,842,998 T184S possibly damaging Het
Lap3 C T 5: 45,495,211 P50S probably benign Het
Mast4 A G 13: 102,735,496 S2263P probably benign Het
Mef2b C T 8: 70,165,597 P109L possibly damaging Het
Meltf T A 16: 31,884,960 F168L probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Nup205 T A 6: 35,234,706 F1661I probably damaging Het
Olfr187 A T 16: 59,035,815 N307K probably benign Het
Olfr747 A T 14: 50,681,016 L206H probably damaging Het
Plac8 A T 5: 100,556,581 D83E probably benign Het
Pnpt1 T C 11: 29,141,328 probably benign Het
Pold2 G T 11: 5,875,140 Q86K probably benign Het
Ptprt A G 2: 161,558,943 L1057P probably damaging Het
Rev3l A G 10: 39,832,639 H2284R probably damaging Het
Skint6 A C 4: 113,238,103 S120A probably benign Het
Slc1a7 G A 4: 108,007,573 V270M probably damaging Het
Spata2 A G 2: 167,485,222 M85T probably benign Het
Taf1b G T 12: 24,509,559 probably benign Het
Tert A G 13: 73,642,059 N844S probably benign Het
Thrap3 G A 4: 126,180,089 S288L possibly damaging Het
Ubap2l A G 3: 90,047,873 probably benign Het
Ubtf T C 11: 102,311,450 E197G possibly damaging Het
Usp20 G T 2: 31,007,813 G216W probably damaging Het
Wdr60 T C 12: 116,232,657 E490G probably damaging Het
Yy1 T A 12: 108,793,531 V40E unknown Het
Zfp335 G A 2: 164,892,585 H1254Y possibly damaging Het
Other mutations in Mamdc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Mamdc2 APN 19 23378774 nonsense probably null
IGL00588:Mamdc2 APN 19 23353316 missense possibly damaging 0.89
IGL01105:Mamdc2 APN 19 23331002 missense probably benign 0.36
IGL02223:Mamdc2 APN 19 23359143 splice site probably benign
IGL02511:Mamdc2 APN 19 23378731 missense probably benign 0.00
IGL02632:Mamdc2 APN 19 23330976 missense probably benign 0.03
IGL02832:Mamdc2 APN 19 23303851 missense probably damaging 0.99
R0071:Mamdc2 UTSW 19 23303630 nonsense probably null
R0121:Mamdc2 UTSW 19 23310859 missense probably benign 0.01
R0732:Mamdc2 UTSW 19 23378869 missense probably damaging 0.98
R1860:Mamdc2 UTSW 19 23359153 missense probably damaging 0.98
R1861:Mamdc2 UTSW 19 23359153 missense probably damaging 0.98
R1996:Mamdc2 UTSW 19 23363925 nonsense probably null
R2012:Mamdc2 UTSW 19 23310851 missense probably benign 0.00
R2016:Mamdc2 UTSW 19 23334029 missense probably damaging 0.98
R2266:Mamdc2 UTSW 19 23303903 splice site probably benign
R2267:Mamdc2 UTSW 19 23303903 splice site probably benign
R2269:Mamdc2 UTSW 19 23303903 splice site probably benign
R3085:Mamdc2 UTSW 19 23310932 missense possibly damaging 0.80
R4235:Mamdc2 UTSW 19 23374017 missense possibly damaging 0.94
R4672:Mamdc2 UTSW 19 23350784 missense probably damaging 1.00
R5074:Mamdc2 UTSW 19 23378796 missense probably benign 0.01
R5084:Mamdc2 UTSW 19 23359152 missense possibly damaging 0.95
R5521:Mamdc2 UTSW 19 23310938 missense probably damaging 1.00
R6119:Mamdc2 UTSW 19 23353315 missense probably damaging 1.00
R6334:Mamdc2 UTSW 19 23363906 missense probably damaging 1.00
R6557:Mamdc2 UTSW 19 23310845 missense possibly damaging 0.80
R6676:Mamdc2 UTSW 19 23303633 missense probably damaging 1.00
R7218:Mamdc2 UTSW 19 23447610 missense probably benign 0.00
R7616:Mamdc2 UTSW 19 23350804 missense probably damaging 1.00
R7627:Mamdc2 UTSW 19 23310991 missense probably damaging 0.99
R8101:Mamdc2 UTSW 19 23334029 missense probably damaging 0.98
Z1176:Mamdc2 UTSW 19 23334057 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TGTCCAAAGCGTTAGCTTCCTGTC -3'
(R):5'- ACAGCCAAAGTGGCTATGTTTCCAG -3'

Sequencing Primer
(F):5'- CAATTATCCGTTCACTGCTTAGAG -3'
(R):5'- GAAAGCACACCTTTTGTCCC -3'
Posted On2014-01-05