Mutagenetix > Incidental Mutations

Incidental Mutation 'R5614:Vgll2'

438150

Institutional Source

Beutler Lab

Gene Symbol

Vgll2

Ensembl Gene

ENSMUSG00000049641

Gene Name

vestigial like family member 2

Synonyms

C130057C21Rik, Vito1, VITO-1, Vgl-2

MMRRC Submission

043275-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.775) question?

Stock #

R5614 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52022502-52028471 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 52025222 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 83 (R83*)

Ref Sequence

ENSEMBL: ENSMUSP00000124091 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058347] [ENSMUST00000163017]

Predicted Effect

probably null
Transcript: ENSMUST00000058347
AA Change: R83*

SMART Domains

Protein: ENSMUSP00000050273
Gene: ENSMUSG00000049641
AA Change: R83*

Domain	Start	End	E-Value	Type
low complexity region	42	61	N/A	INTRINSIC
Pfam:Vg_Tdu	78	110	7.6e-27	PFAM
low complexity region	192	204	N/A	INTRINSIC
low complexity region	206	213	N/A	INTRINSIC
low complexity region	245	262	N/A	INTRINSIC
low complexity region	269	282	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000163017
AA Change: R83*

SMART Domains

Protein: ENSMUSP00000124091
Gene: ENSMUSG00000049641
AA Change: R83*

Domain	Start	End	E-Value	Type
low complexity region	42	61	N/A	INTRINSIC
Pfam:Vg_Tdu	78	108	1.1e-23	PFAM
low complexity region	193	205	N/A	INTRINSIC
low complexity region	207	214	N/A	INTRINSIC
low complexity region	246	263	N/A	INTRINSIC
low complexity region	270	283	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: This gene is a member of the Vestigial-like (Vgl) gene family and is upregulated during muscle differentiation. The product of this gene interacts with and modifies the DNA-binding properties of the transcription factor, TEF-1, and is important for muscle tissue development. Reduced expression of this gene leads to a reduction in the terminal differentiation of muscle cells. Alternate splicing results in multiple protein isoforms. [provided by RefSeq, Jul 2014]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	G	A	5: 24,550,142	A330V	probably benign	Het
Abca1	A	G	4: 53,046,132	V1712A	probably damaging	Het
Ankmy2	T	C	12: 36,193,784	S333P	probably damaging	Het
Arfrp1	A	G	2: 181,359,443		probably benign	Het
Atp13a2	A	G	4: 140,992,182	T21A	probably benign	Het
Bud23	C	A	5: 135,059,112	A152S	probably benign	Het
Cant1	T	C	11: 118,408,743	D260G	probably benign	Het
Ces1b	T	C	8: 93,068,208	I254M	probably benign	Het
Ces1d	T	C	8: 93,176,204	T375A	probably benign	Het
Cfap54	A	G	10: 93,045,049	L384P	probably damaging	Het
Chrne	C	T	11: 70,615,053	V469I	possibly damaging	Het
Clspn	A	G	4: 126,580,962	E968G	probably damaging	Het
Col5a3	A	G	9: 20,783,476		probably benign	Het
Dtx4	T	C	19: 12,482,183	Y419C	probably damaging	Het
Fam171b	T	A	2: 83,812,873	I42N	probably damaging	Het
Fam43a	T	C	16: 30,601,672	I358T	possibly damaging	Het
Fasn	T	C	11: 120,813,328	S1422G	probably benign	Het
Fig4	A	T	10: 41,272,985	V157E	probably damaging	Het
Fus	T	C	7: 127,974,371		probably benign	Het
Hmcn2	G	T	2: 31,428,303	V3887F	probably damaging	Het
Hmgcll1	A	G	9: 76,081,393	Y182C	probably damaging	Het
Hook2	T	A	8: 85,002,508	I585N	probably damaging	Het
Iars2	T	C	1: 185,289,508	T866A	probably benign	Het
Lrit1	T	A	14: 37,061,954	M413K	probably benign	Het
Myl9	G	A	2: 156,781,163		probably benign	Het
Nelfa	A	T	5: 33,920,500	L179Q	probably damaging	Het
Nod2	A	T	8: 88,664,196	D355V	probably damaging	Het
Npbwr1	A	T	1: 5,916,811	S161R	probably damaging	Het
Nxpe2	A	T	9: 48,323,101	F289I	probably benign	Het
Odf2	A	G	2: 29,920,867	I538M	probably damaging	Het
Osbpl6	T	A	2: 76,568,109	V379E	probably damaging	Het
Pkhd1	A	G	1: 20,073,526	C3859R	possibly damaging	Het
Rgs1	G	T	1: 144,246,257	T99N	probably benign	Het
Rnf6	T	C	5: 146,218,100		probably null	Het
Rtp1	C	A	16: 23,431,190	Q102K	possibly damaging	Het
Sec24c	T	A	14: 20,682,738	V123E	possibly damaging	Het
Serpini2	T	C	3: 75,257,707		probably benign	Het
Stxbp5	A	T	10: 9,760,894		probably benign	Het
Tecta	A	G	9: 42,339,055	S1809P	probably damaging	Het
Tgfb2	T	A	1: 186,625,513	I394F	probably benign	Het
Thg1l	T	C	11: 45,950,227	Y175C	possibly damaging	Het
Tmem67	C	A	4: 12,061,755	K572N	possibly damaging	Het
Tollip	T	C	7: 141,892,088	T19A	probably damaging	Het
Ttn	A	G	2: 76,712,107	Y25185H	probably damaging	Het
Wfdc8	G	T	2: 164,603,203	A164E	probably damaging	Het
Ylpm1	T	C	12: 85,064,944		probably benign	Het
Zfp326	T	A	5: 105,888,495	S91T	probably damaging	Het
Zfp638	T	C	6: 83,929,641	F263L	probably damaging	Het
Zfp800	G	A	6: 28,243,136	T610I	probably damaging	Het
Zmym4	A	G	4: 126,910,936	F475L	possibly damaging	Het

Other mutations in Vgll2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02436:Vgll2	APN	10	52025222	nonsense	probably null
R1796:Vgll2	UTSW	10	52025228	missense	probably damaging	1.00
R5193:Vgll2	UTSW	10	52027992	missense	possibly damaging	0.96
R5397:Vgll2	UTSW	10	52025166	missense	probably damaging	1.00
R5766:Vgll2	UTSW	10	52027563	missense	probably damaging	1.00
R5842:Vgll2	UTSW	10	52025292	missense	probably damaging	1.00
R7063:Vgll2	UTSW	10	52027976	missense	probably benign	0.00
R7272:Vgll2	UTSW	10	52027662	missense	possibly damaging	0.76
Z1176:Vgll2	UTSW	10	52027602	missense	possibly damaging	0.94
Z1177:Vgll2	UTSW	10	52027808	missense	probably benign	0.34

Predicted Primers

PCR Primer
(F):5'- TGGATACGTTCAGGATGCAC -3'
(R):5'- ACCTACTCTTCTCCATGGGGAC -3'

Sequencing Primer
(F):5'- GGATGCACCTATATTGACCATCTC -3'
(R):5'- GGGACCCACTCACCTCTC -3'

Posted On

2016-10-26