Incidental Mutation 'R5614:Vgll2'
ID 438150
Institutional Source Beutler Lab
Gene Symbol Vgll2
Ensembl Gene ENSMUSG00000049641
Gene Name vestigial like family member 2
Synonyms C130057C21Rik, Vito1, VITO-1, Vgl-2
MMRRC Submission 043275-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.748) question?
Stock # R5614 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 52022502-52028471 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 52025222 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 83 (R83*)
Ref Sequence ENSEMBL: ENSMUSP00000124091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058347] [ENSMUST00000163017]
AlphaFold Q8BGW8
Predicted Effect probably null
Transcript: ENSMUST00000058347
AA Change: R83*
SMART Domains Protein: ENSMUSP00000050273
Gene: ENSMUSG00000049641
AA Change: R83*

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
Pfam:Vg_Tdu 78 110 7.6e-27 PFAM
low complexity region 192 204 N/A INTRINSIC
low complexity region 206 213 N/A INTRINSIC
low complexity region 245 262 N/A INTRINSIC
low complexity region 269 282 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163017
AA Change: R83*
SMART Domains Protein: ENSMUSP00000124091
Gene: ENSMUSG00000049641
AA Change: R83*

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
Pfam:Vg_Tdu 78 108 1.1e-23 PFAM
low complexity region 193 205 N/A INTRINSIC
low complexity region 207 214 N/A INTRINSIC
low complexity region 246 263 N/A INTRINSIC
low complexity region 270 283 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene is a member of the Vestigial-like (Vgl) gene family and is upregulated during muscle differentiation. The product of this gene interacts with and modifies the DNA-binding properties of the transcription factor, TEF-1, and is important for muscle tissue development. Reduced expression of this gene leads to a reduction in the terminal differentiation of muscle cells. Alternate splicing results in multiple protein isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G A 5: 24,550,142 A330V probably benign Het
Abca1 A G 4: 53,046,132 V1712A probably damaging Het
Ankmy2 T C 12: 36,193,784 S333P probably damaging Het
Arfrp1 A G 2: 181,359,443 probably benign Het
Atp13a2 A G 4: 140,992,182 T21A probably benign Het
Bud23 C A 5: 135,059,112 A152S probably benign Het
Cant1 T C 11: 118,408,743 D260G probably benign Het
Ces1b T C 8: 93,068,208 I254M probably benign Het
Ces1d T C 8: 93,176,204 T375A probably benign Het
Cfap54 A G 10: 93,045,049 L384P probably damaging Het
Chrne C T 11: 70,615,053 V469I possibly damaging Het
Clspn A G 4: 126,580,962 E968G probably damaging Het
Col5a3 A G 9: 20,783,476 probably benign Het
Dtx4 T C 19: 12,482,183 Y419C probably damaging Het
Fam171b T A 2: 83,812,873 I42N probably damaging Het
Fam43a T C 16: 30,601,672 I358T possibly damaging Het
Fasn T C 11: 120,813,328 S1422G probably benign Het
Fig4 A T 10: 41,272,985 V157E probably damaging Het
Fus T C 7: 127,974,371 probably benign Het
Hmcn2 G T 2: 31,428,303 V3887F probably damaging Het
Hmgcll1 A G 9: 76,081,393 Y182C probably damaging Het
Hook2 T A 8: 85,002,508 I585N probably damaging Het
Iars2 T C 1: 185,289,508 T866A probably benign Het
Lrit1 T A 14: 37,061,954 M413K probably benign Het
Myl9 G A 2: 156,781,163 probably benign Het
Nelfa A T 5: 33,920,500 L179Q probably damaging Het
Nod2 A T 8: 88,664,196 D355V probably damaging Het
Npbwr1 A T 1: 5,916,811 S161R probably damaging Het
Nxpe2 A T 9: 48,323,101 F289I probably benign Het
Odf2 A G 2: 29,920,867 I538M probably damaging Het
Osbpl6 T A 2: 76,568,109 V379E probably damaging Het
Pkhd1 A G 1: 20,073,526 C3859R possibly damaging Het
Rgs1 G T 1: 144,246,257 T99N probably benign Het
Rnf6 T C 5: 146,218,100 probably null Het
Rtp1 C A 16: 23,431,190 Q102K possibly damaging Het
Sec24c T A 14: 20,682,738 V123E possibly damaging Het
Serpini2 T C 3: 75,257,707 probably benign Het
Stxbp5 A T 10: 9,760,894 probably benign Het
Tecta A G 9: 42,339,055 S1809P probably damaging Het
Tgfb2 T A 1: 186,625,513 I394F probably benign Het
Thg1l T C 11: 45,950,227 Y175C possibly damaging Het
Tmem67 C A 4: 12,061,755 K572N possibly damaging Het
Tollip T C 7: 141,892,088 T19A probably damaging Het
Ttn A G 2: 76,712,107 Y25185H probably damaging Het
Wfdc8 G T 2: 164,603,203 A164E probably damaging Het
Ylpm1 T C 12: 85,064,944 probably benign Het
Zfp326 T A 5: 105,888,495 S91T probably damaging Het
Zfp638 T C 6: 83,929,641 F263L probably damaging Het
Zfp800 G A 6: 28,243,136 T610I probably damaging Het
Zmym4 A G 4: 126,910,936 F475L possibly damaging Het
Other mutations in Vgll2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02436:Vgll2 APN 10 52025222 nonsense probably null
R1796:Vgll2 UTSW 10 52025228 missense probably damaging 1.00
R5193:Vgll2 UTSW 10 52027992 missense possibly damaging 0.96
R5397:Vgll2 UTSW 10 52025166 missense probably damaging 1.00
R5766:Vgll2 UTSW 10 52027563 missense probably damaging 1.00
R5842:Vgll2 UTSW 10 52025292 missense probably damaging 1.00
R7063:Vgll2 UTSW 10 52027976 missense probably benign 0.00
R7272:Vgll2 UTSW 10 52027662 missense possibly damaging 0.76
R9175:Vgll2 UTSW 10 52027539 missense probably damaging 1.00
Z1176:Vgll2 UTSW 10 52027602 missense possibly damaging 0.94
Z1177:Vgll2 UTSW 10 52027808 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TGGATACGTTCAGGATGCAC -3'
(R):5'- ACCTACTCTTCTCCATGGGGAC -3'

Sequencing Primer
(F):5'- GGATGCACCTATATTGACCATCTC -3'
(R):5'- GGGACCCACTCACCTCTC -3'
Posted On 2016-10-26