Incidental Mutation 'R5655:Slc27a2'
ID442221
Institutional Source Beutler Lab
Gene Symbol Slc27a2
Ensembl Gene ENSMUSG00000027359
Gene Namesolute carrier family 27 (fatty acid transporter), member 2
SynonymsVLCS, ACSVL1, Vlac, FATP2, FATP2, Vlacs
MMRRC Submission 043301-MU
Accession Numbers

Genbank: NM_011978.2 ; Ensembl: ENSMUST00000061491, ENSMUST00000141482, ENSMUST00000126249, ENSMUST00000150947

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5655 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location126552407-126588243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126578939 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 314 (L314P)
Ref Sequence ENSEMBL: ENSMUSP00000117145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061491] [ENSMUST00000141482]
Predicted Effect probably damaging
Transcript: ENSMUST00000061491
AA Change: L450P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057595
Gene: ENSMUSG00000027359
AA Change: L450P

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 41 53 N/A INTRINSIC
Pfam:AMP-binding 59 488 1.4e-71 PFAM
Pfam:AMP-binding_C 496 572 1.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141482
AA Change: L314P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117145
Gene: ENSMUSG00000027359
AA Change: L314P

DomainStartEndE-ValueType
Pfam:AMP-binding 7 256 6.2e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150947
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme activates long-chain, branched-chain and very-long-chain fatty acids containing 22 or more carbons to their CoA derivatives. It is expressed primarily in liver and kidney, and is present in both endoplasmic reticulum and peroxisomes, but not in mitochondria. Its decreased peroxisomal enzyme activity is in part responsible for the biochemical pathology in X-linked adrenoleukodystrophy. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous mutant mice are viable and show no gross morphological abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T A 5: 103,648,880 I99F probably benign Het
Acan G A 7: 79,100,043 D1521N possibly damaging Het
Acap3 C T 4: 155,896,619 T53I probably benign Het
Actr3b G T 5: 25,848,368 V232F probably damaging Het
Adgrl1 G A 8: 83,938,601 V1311M possibly damaging Het
Arhgap23 T C 11: 97,452,546 probably null Het
Asns A C 6: 7,685,309 M116R probably benign Het
Asprv1 A T 6: 86,628,482 E103D probably benign Het
Atxn2 T C 5: 121,747,426 I232T probably damaging Het
B020004C17Rik C T 14: 57,015,232 probably benign Het
Bckdha A G 7: 25,630,364 Y414H probably damaging Het
Bod1l G A 5: 41,817,044 T2309M probably benign Het
Cacna2d1 T A 5: 16,302,335 F361I probably damaging Het
Cdc45 C T 16: 18,807,279 probably null Het
Cog4 A G 8: 110,863,307 Y368C probably damaging Het
Cyp4a12b C G 4: 115,433,797 H341D probably damaging Het
Ddx10 A T 9: 53,209,687 probably null Het
Dnah12 A T 14: 26,710,269 Y414F probably benign Het
Dync1h1 A G 12: 110,629,062 K1445R probably benign Het
Dync2h1 A C 9: 7,148,659 D928E probably benign Het
Dzip1 T A 14: 118,887,232 probably null Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fgf14 T C 14: 124,192,416 N36D probably benign Het
Fmnl3 A T 15: 99,321,862 F668L probably damaging Het
Foxl2 C T 9: 98,955,995 P112L probably damaging Het
Foxp2 T G 6: 15,197,113 H51Q probably damaging Het
Frem3 A T 8: 80,612,694 T539S probably benign Het
Ftcd G T 10: 76,588,103 G493C probably damaging Het
Gab2 A G 7: 97,298,892 S230G probably benign Het
Gabra1 A T 11: 42,182,923 probably null Het
Gm14496 A T 2: 181,996,182 I350L probably benign Het
Idh2 A C 7: 80,098,248 C235G probably damaging Het
Ift140 C T 17: 25,045,064 L514F probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lamc3 C A 2: 31,925,717 R1142S probably benign Het
Lman1l C T 9: 57,615,975 V100M probably damaging Het
Lmod2 A T 6: 24,603,854 H276L possibly damaging Het
Lrrc37a T A 11: 103,498,555 I2015L probably benign Het
Mcf2l A G 8: 13,010,444 E764G probably damaging Het
Mcph1 G A 8: 18,788,310 M749I probably benign Het
Msh2 C T 17: 87,719,443 A789V possibly damaging Het
Ndufa2 T C 18: 36,744,466 I19V probably benign Het
Neurod4 T A 10: 130,271,133 K91* probably null Het
Nos1 G T 5: 117,923,257 G883C probably damaging Het
Npdc1 A T 2: 25,407,680 H121L possibly damaging Het
Olfr139 A C 11: 74,044,334 Y313* probably null Het
Olfr318 G A 11: 58,720,251 H266Y probably damaging Het
Orc1 A G 4: 108,593,439 I123V probably benign Het
P2ry13 C T 3: 59,209,839 V173M possibly damaging Het
Park2 C T 17: 11,237,649 A119V probably damaging Het
Pigk T A 3: 152,740,221 N156K probably damaging Het
Pik3ap1 A T 19: 41,298,241 F569Y possibly damaging Het
Pla2g4c T A 7: 13,329,964 probably null Het
Plk3 A G 4: 117,131,480 L324P probably damaging Het
Pom121 A G 5: 135,392,317 S260P unknown Het
Prrt2 G A 7: 127,019,402 A297V probably damaging Het
Prss47 A T 13: 65,045,043 V308E probably damaging Het
Ptbp2 T C 3: 119,724,157 I139V probably benign Het
Ptprz1 A T 6: 22,999,773 M621L probably benign Het
Rab6a G A 7: 100,608,294 probably null Het
Ranbp1 C T 16: 18,241,805 D127N probably damaging Het
Rnpepl1 G T 1: 92,919,310 R272L probably damaging Het
Slc6a5 A T 7: 49,956,470 M709L probably benign Het
Smarcc1 A T 9: 110,157,344 S238C probably null Het
Snx29 C T 16: 11,755,321 L476F probably damaging Het
Sorbs2 T C 8: 45,741,581 probably null Het
St6galnac2 T C 11: 116,685,146 N160D probably damaging Het
Thsd7b A G 1: 129,628,934 probably null Het
Trpc4ap G A 2: 155,653,627 T306I possibly damaging Het
Ubr5 T G 15: 38,015,093 Y891S probably damaging Het
Vmn1r220 A G 13: 23,184,128 F133L probably benign Het
Vmn1r56 T A 7: 5,195,701 I306F possibly damaging Het
Vmn1r67 T C 7: 10,447,388 V193A probably benign Het
Yipf1 T A 4: 107,345,157 V239E probably damaging Het
Zfp7 G T 15: 76,891,429 C557F probably damaging Het
Other mutations in Slc27a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Slc27a2 APN 2 126580917 missense probably damaging 1.00
IGL01907:Slc27a2 APN 2 126587874 missense probably benign 0.02
IGL02185:Slc27a2 APN 2 126567816 missense probably damaging 0.99
IGL02363:Slc27a2 APN 2 126578950 missense possibly damaging 0.58
IGL02451:Slc27a2 APN 2 126578992 missense probably benign 0.00
IGL02486:Slc27a2 APN 2 126553350 missense probably benign 0.00
IGL03217:Slc27a2 APN 2 126586252 missense possibly damaging 0.80
IGL03287:Slc27a2 APN 2 126553392 missense probably damaging 1.00
IGL03291:Slc27a2 APN 2 126564750 missense probably benign 0.14
baseboard UTSW 2 126567780 missense probably damaging 0.97
B6584:Slc27a2 UTSW 2 126561642 missense possibly damaging 0.94
R0021:Slc27a2 UTSW 2 126567886 splice site probably benign
R0647:Slc27a2 UTSW 2 126587916 missense probably benign 0.00
R1326:Slc27a2 UTSW 2 126564770 missense probably damaging 1.00
R1509:Slc27a2 UTSW 2 126553314 missense possibly damaging 0.95
R1907:Slc27a2 UTSW 2 126586342 missense probably benign 0.13
R2012:Slc27a2 UTSW 2 126553615 missense probably damaging 0.98
R2217:Slc27a2 UTSW 2 126567752 missense probably damaging 0.99
R3769:Slc27a2 UTSW 2 126567798 missense possibly damaging 0.90
R3770:Slc27a2 UTSW 2 126567798 missense possibly damaging 0.90
R5244:Slc27a2 UTSW 2 126578855 missense probably benign 0.00
R5459:Slc27a2 UTSW 2 126580992 missense probably damaging 0.98
R5582:Slc27a2 UTSW 2 126564690 missense probably damaging 1.00
R5606:Slc27a2 UTSW 2 126564690 missense probably damaging 1.00
R5680:Slc27a2 UTSW 2 126561610 missense probably benign 0.02
R5747:Slc27a2 UTSW 2 126564738 missense probably benign
R6346:Slc27a2 UTSW 2 126587880 missense probably damaging 0.97
R7042:Slc27a2 UTSW 2 126567780 missense probably damaging 0.97
R7297:Slc27a2 UTSW 2 126578946 missense probably damaging 0.99
R7323:Slc27a2 UTSW 2 126553204 missense probably benign 0.38
R7391:Slc27a2 UTSW 2 126553162 missense unknown
RF008:Slc27a2 UTSW 2 126553255 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCCTATAGCCAACGTATTGCC -3'
(R):5'- CTGGCTTCGGAATAGAGCAAAG -3'

Sequencing Primer
(F):5'- AACGTATTGCCAGCGGG -3'
(R):5'- CAAAGTGTGCATGTCATGTATTTG -3'
Posted On2016-11-09