Incidental Mutation 'R5655:St6galnac2'
ID442280
Institutional Source Beutler Lab
Gene Symbol St6galnac2
Ensembl Gene ENSMUSG00000110170
Gene NameST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
SynonymsSiat7b, ST6GalNAc II, Siat7
MMRRC Submission 043301-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R5655 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location116677483-116681290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116685146 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 160 (N160D)
Ref Sequence ENSEMBL: ENSMUSP00000078501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079545] [ENSMUST00000144398]
Predicted Effect probably damaging
Transcript: ENSMUST00000079545
AA Change: N160D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078501
Gene: ENSMUSG00000057286
AA Change: N160D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_transf_29 90 373 2.9e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129236
Predicted Effect probably benign
Transcript: ENSMUST00000144398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145441
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ST6GALNAC2 belongs to a family of sialyltransferases that add sialic acids to the nonreducing ends of glycoconjugates. At the cell surface, these modifications have roles in cell-cell and cell-substrate interactions, bacterial adhesion, and protein targeting (Samyn-Petit et al., 2000 [PubMed 10742600]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased body weight, decreased IgQ, increased B cell proliferation, increased pre-B cell number, abnormal erythropoiesis, increased ALT, decreased creatinine level and prominent spleen germinal center. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T A 5: 103,648,880 I99F probably benign Het
Acan G A 7: 79,100,043 D1521N possibly damaging Het
Acap3 C T 4: 155,896,619 T53I probably benign Het
Actr3b G T 5: 25,848,368 V232F probably damaging Het
Adgrl1 G A 8: 83,938,601 V1311M possibly damaging Het
Arhgap23 T C 11: 97,452,546 probably null Het
Asns A C 6: 7,685,309 M116R probably benign Het
Asprv1 A T 6: 86,628,482 E103D probably benign Het
Atxn2 T C 5: 121,747,426 I232T probably damaging Het
B020004C17Rik C T 14: 57,015,232 probably benign Het
Bckdha A G 7: 25,630,364 Y414H probably damaging Het
Bod1l G A 5: 41,817,044 T2309M probably benign Het
Cacna2d1 T A 5: 16,302,335 F361I probably damaging Het
Cdc45 C T 16: 18,807,279 probably null Het
Cog4 A G 8: 110,863,307 Y368C probably damaging Het
Cyp4a12b C G 4: 115,433,797 H341D probably damaging Het
Ddx10 A T 9: 53,209,687 probably null Het
Dnah12 A T 14: 26,710,269 Y414F probably benign Het
Dync1h1 A G 12: 110,629,062 K1445R probably benign Het
Dync2h1 A C 9: 7,148,659 D928E probably benign Het
Dzip1 T A 14: 118,887,232 probably null Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fgf14 T C 14: 124,192,416 N36D probably benign Het
Fmnl3 A T 15: 99,321,862 F668L probably damaging Het
Foxl2 C T 9: 98,955,995 P112L probably damaging Het
Foxp2 T G 6: 15,197,113 H51Q probably damaging Het
Frem3 A T 8: 80,612,694 T539S probably benign Het
Ftcd G T 10: 76,588,103 G493C probably damaging Het
Gab2 A G 7: 97,298,892 S230G probably benign Het
Gabra1 A T 11: 42,182,923 probably null Het
Gm14496 A T 2: 181,996,182 I350L probably benign Het
Idh2 A C 7: 80,098,248 C235G probably damaging Het
Ift140 C T 17: 25,045,064 L514F probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lamc3 C A 2: 31,925,717 R1142S probably benign Het
Lman1l C T 9: 57,615,975 V100M probably damaging Het
Lmod2 A T 6: 24,603,854 H276L possibly damaging Het
Lrrc37a T A 11: 103,498,555 I2015L probably benign Het
Mcf2l A G 8: 13,010,444 E764G probably damaging Het
Mcph1 G A 8: 18,788,310 M749I probably benign Het
Msh2 C T 17: 87,719,443 A789V possibly damaging Het
Ndufa2 T C 18: 36,744,466 I19V probably benign Het
Neurod4 T A 10: 130,271,133 K91* probably null Het
Nos1 G T 5: 117,923,257 G883C probably damaging Het
Npdc1 A T 2: 25,407,680 H121L possibly damaging Het
Olfr139 A C 11: 74,044,334 Y313* probably null Het
Olfr318 G A 11: 58,720,251 H266Y probably damaging Het
Orc1 A G 4: 108,593,439 I123V probably benign Het
P2ry13 C T 3: 59,209,839 V173M possibly damaging Het
Park2 C T 17: 11,237,649 A119V probably damaging Het
Pigk T A 3: 152,740,221 N156K probably damaging Het
Pik3ap1 A T 19: 41,298,241 F569Y possibly damaging Het
Pla2g4c T A 7: 13,329,964 probably null Het
Plk3 A G 4: 117,131,480 L324P probably damaging Het
Pom121 A G 5: 135,392,317 S260P unknown Het
Prrt2 G A 7: 127,019,402 A297V probably damaging Het
Prss47 A T 13: 65,045,043 V308E probably damaging Het
Ptbp2 T C 3: 119,724,157 I139V probably benign Het
Ptprz1 A T 6: 22,999,773 M621L probably benign Het
Rab6a G A 7: 100,608,294 probably null Het
Ranbp1 C T 16: 18,241,805 D127N probably damaging Het
Rnpepl1 G T 1: 92,919,310 R272L probably damaging Het
Slc27a2 T C 2: 126,578,939 L314P probably damaging Het
Slc6a5 A T 7: 49,956,470 M709L probably benign Het
Smarcc1 A T 9: 110,157,344 S238C probably null Het
Snx29 C T 16: 11,755,321 L476F probably damaging Het
Sorbs2 T C 8: 45,741,581 probably null Het
Thsd7b A G 1: 129,628,934 probably null Het
Trpc4ap G A 2: 155,653,627 T306I possibly damaging Het
Ubr5 T G 15: 38,015,093 Y891S probably damaging Het
Vmn1r220 A G 13: 23,184,128 F133L probably benign Het
Vmn1r56 T A 7: 5,195,701 I306F possibly damaging Het
Vmn1r67 T C 7: 10,447,388 V193A probably benign Het
Yipf1 T A 4: 107,345,157 V239E probably damaging Het
Zfp7 G T 15: 76,891,429 C557F probably damaging Het
Other mutations in St6galnac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01714:St6galnac2 APN 11 116685119 missense probably damaging 1.00
IGL01726:St6galnac2 APN 11 116685119 missense probably damaging 1.00
IGL01727:St6galnac2 APN 11 116685119 missense probably damaging 1.00
IGL01733:St6galnac2 APN 11 116685119 missense probably damaging 1.00
IGL03353:St6galnac2 APN 11 116690302 splice site probably benign
R1521:St6galnac2 UTSW 11 116684347 missense possibly damaging 0.79
R1524:St6galnac2 UTSW 11 116684487 unclassified probably benign
R1855:St6galnac2 UTSW 11 116690315 missense probably benign 0.02
R2307:St6galnac2 UTSW 11 116681905 missense probably damaging 1.00
R4079:St6galnac2 UTSW 11 116681898 missense possibly damaging 0.69
R4658:St6galnac2 UTSW 11 116684525 unclassified probably benign
R5174:St6galnac2 UTSW 11 116681947 missense probably damaging 0.99
R5436:St6galnac2 UTSW 11 116684527 unclassified probably benign
R6584:St6galnac2 UTSW 11 116694504 missense probably benign 0.06
R6702:St6galnac2 UTSW 11 116684387 missense probably benign 0.38
R6703:St6galnac2 UTSW 11 116684387 missense probably benign 0.38
R7090:St6galnac2 UTSW 11 116677635 missense probably damaging 1.00
R7368:St6galnac2 UTSW 11 116679979 missense probably damaging 1.00
R7607:St6galnac2 UTSW 11 116679979 missense probably damaging 1.00
R7728:St6galnac2 UTSW 11 116679985 missense probably benign 0.02
R7751:St6galnac2 UTSW 11 116677584 missense probably damaging 1.00
R7851:St6galnac2 UTSW 11 116685938 missense probably benign 0.04
R7934:St6galnac2 UTSW 11 116685938 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCTTCAGGGTTGGCTGATCC -3'
(R):5'- TCCATAACGTAGGTCCCAGG -3'

Sequencing Primer
(F):5'- CGATAGTCTTTCAGGTGACCC -3'
(R):5'- TGTCCAGGGGTAAGCCTG -3'
Posted On2016-11-09