Incidental Mutation 'R5667:Plekhg2'
ID444473
Institutional Source Beutler Lab
Gene Symbol Plekhg2
Ensembl Gene ENSMUSG00000037552
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 2
SynonymsClg
MMRRC Submission 043310-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock #R5667 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location28359604-28372599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28367639 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 356 (I356N)
Ref Sequence ENSEMBL: ENSMUSP00000115651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094644] [ENSMUST00000119990] [ENSMUST00000121085] [ENSMUST00000144700] [ENSMUST00000147362] [ENSMUST00000147887] [ENSMUST00000152281]
Predicted Effect probably damaging
Transcript: ENSMUST00000094644
AA Change: I357N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092228
Gene: ENSMUSG00000037552
AA Change: I357N

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
low complexity region 46 63 N/A INTRINSIC
low complexity region 73 88 N/A INTRINSIC
RhoGEF 103 279 3.98e-49 SMART
PH 305 410 3.01e-8 SMART
low complexity region 463 481 N/A INTRINSIC
low complexity region 582 605 N/A INTRINSIC
low complexity region 842 856 N/A INTRINSIC
low complexity region 1232 1246 N/A INTRINSIC
low complexity region 1268 1292 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119990
AA Change: I356N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112881
Gene: ENSMUSG00000037552
AA Change: I356N

DomainStartEndE-ValueType
low complexity region 45 62 N/A INTRINSIC
low complexity region 72 87 N/A INTRINSIC
RhoGEF 102 278 3.98e-49 SMART
PH 304 409 3.01e-8 SMART
low complexity region 462 480 N/A INTRINSIC
low complexity region 581 604 N/A INTRINSIC
low complexity region 841 855 N/A INTRINSIC
low complexity region 1231 1245 N/A INTRINSIC
low complexity region 1267 1291 N/A INTRINSIC
low complexity region 1319 1333 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121085
AA Change: I356N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113449
Gene: ENSMUSG00000037552
AA Change: I356N

DomainStartEndE-ValueType
low complexity region 45 62 N/A INTRINSIC
low complexity region 72 87 N/A INTRINSIC
RhoGEF 102 278 3.98e-49 SMART
PH 304 409 3.01e-8 SMART
low complexity region 462 479 N/A INTRINSIC
low complexity region 606 629 N/A INTRINSIC
low complexity region 866 880 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
low complexity region 1292 1316 N/A INTRINSIC
low complexity region 1344 1358 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129145
Predicted Effect probably damaging
Transcript: ENSMUST00000144700
AA Change: I356N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115651
Gene: ENSMUSG00000037552
AA Change: I356N

DomainStartEndE-ValueType
low complexity region 45 62 N/A INTRINSIC
low complexity region 72 87 N/A INTRINSIC
RhoGEF 102 278 3.98e-49 SMART
PH 304 409 3.01e-8 SMART
low complexity region 462 480 N/A INTRINSIC
low complexity region 581 604 N/A INTRINSIC
low complexity region 841 855 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147362
SMART Domains Protein: ENSMUSP00000118217
Gene: ENSMUSG00000037552

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
low complexity region 46 63 N/A INTRINSIC
low complexity region 73 88 N/A INTRINSIC
Pfam:RhoGEF 103 205 3.1e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147767
Predicted Effect probably benign
Transcript: ENSMUST00000147887
SMART Domains Protein: ENSMUSP00000122050
Gene: ENSMUSG00000037552

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
low complexity region 46 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152281
Meta Mutation Damage Score 0.524 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930444G20Rik T A 10: 22,066,843 T413S possibly damaging Het
4932438A13Rik A T 3: 36,917,677 T520S probably benign Het
Adamts16 A T 13: 70,836,375 Y56* probably null Het
Ak2 T A 4: 129,008,247 F238I probably damaging Het
Akap8l T C 17: 32,338,292 Y115C probably damaging Het
Alms1 A G 6: 85,696,771 D3116G probably damaging Het
Arhgap24 T G 5: 102,846,171 probably null Het
Arhgap45 A G 10: 80,025,476 E491G probably damaging Het
Atp8b1 C T 18: 64,581,923 C86Y probably damaging Het
Atxn1 T C 13: 45,557,377 K693R probably benign Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
Btbd10 T C 7: 113,332,724 K165R probably damaging Het
Capn11 C T 17: 45,639,674 R293Q possibly damaging Het
Chordc1 T G 9: 18,295,332 F33V probably damaging Het
Clca4b G A 3: 144,921,863 T449I probably benign Het
Clip4 A C 17: 71,789,883 M1L probably damaging Het
Cyfip1 C T 7: 55,873,730 T90I probably benign Het
Cyp4v3 G T 8: 45,308,535 T417K possibly damaging Het
D430042O09Rik T A 7: 125,843,455 probably null Het
Exoc3l4 T C 12: 111,423,417 I142T probably damaging Het
Flnb T A 14: 7,890,843 I575N probably benign Het
Foxa1 A T 12: 57,542,295 S380T probably benign Het
Foxi2 A T 7: 135,410,939 probably null Het
Gad1-ps A T 10: 99,444,533 noncoding transcript Het
Gpa33 A G 1: 166,146,791 T66A possibly damaging Het
Gpr45 A G 1: 43,033,058 Y287C probably damaging Het
H2-Eb1 C A 17: 34,314,255 Y150* probably null Het
H2-Ke6 T C 17: 34,026,461 D233G probably null Het
Ifna6 A T 4: 88,827,669 Q85L probably damaging Het
Ivns1abp G T 1: 151,354,009 L149F probably benign Het
Kank4 A G 4: 98,765,461 probably null Het
Lama2 A T 10: 27,190,544 C1114S probably damaging Het
Lmbr1l A C 15: 98,907,608 D337E possibly damaging Het
Lrrn3 A C 12: 41,452,298 S673R possibly damaging Het
Ly75 T C 2: 60,308,311 D1404G probably damaging Het
Muc4 A G 16: 32,753,720 T1199A probably benign Het
Mycn A T 12: 12,940,044 M117K possibly damaging Het
Nalcn A G 14: 123,295,406 I1314T probably damaging Het
Nod1 T C 6: 54,933,576 T869A probably benign Het
Olfr1285 C T 2: 111,408,473 noncoding transcript Het
Olfr1388 T C 11: 49,444,313 V154A probably benign Het
Ptpru T A 4: 131,820,190 Y112F possibly damaging Het
Rpl36al G A 12: 69,183,123 P5L possibly damaging Het
Ryr2 A G 13: 11,759,836 W1145R probably damaging Het
Slc11a2 A G 15: 100,403,288 Y295H probably damaging Het
Slc22a6 A G 19: 8,621,784 probably null Het
Styxl1 A G 5: 135,757,123 probably null Het
Tmc6 A G 11: 117,775,615 S288P possibly damaging Het
Trpv4 A G 5: 114,634,556 L371P probably damaging Het
Usp8 A G 2: 126,742,425 D518G probably benign Het
Washc4 T C 10: 83,570,028 S463P probably damaging Het
Other mutations in Plekhg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Plekhg2 APN 7 28360869 nonsense probably null
IGL00933:Plekhg2 APN 7 28360689 missense probably benign 0.01
IGL02037:Plekhg2 APN 7 28368697 missense probably damaging 1.00
IGL02103:Plekhg2 APN 7 28360076 missense probably damaging 1.00
IGL02598:Plekhg2 APN 7 28360475 missense possibly damaging 0.55
IGL02892:Plekhg2 APN 7 28362917 missense probably damaging 1.00
IGL03249:Plekhg2 APN 7 28368002 missense probably damaging 1.00
R0561:Plekhg2 UTSW 7 28370483 missense probably benign
R1134:Plekhg2 UTSW 7 28362001 missense probably damaging 0.99
R1619:Plekhg2 UTSW 7 28368421 missense probably damaging 1.00
R2225:Plekhg2 UTSW 7 28360335 missense probably benign 0.02
R4043:Plekhg2 UTSW 7 28364719 unclassified probably benign
R4117:Plekhg2 UTSW 7 28360888 missense probably benign 0.02
R4296:Plekhg2 UTSW 7 28371166 missense probably damaging 1.00
R4956:Plekhg2 UTSW 7 28368355 missense probably damaging 1.00
R5376:Plekhg2 UTSW 7 28362669 missense probably damaging 0.99
R5378:Plekhg2 UTSW 7 28362669 missense probably damaging 0.99
R5523:Plekhg2 UTSW 7 28370431 missense probably damaging 1.00
R5545:Plekhg2 UTSW 7 28362461 missense probably damaging 1.00
R5913:Plekhg2 UTSW 7 28364602 missense probably damaging 0.99
R6017:Plekhg2 UTSW 7 28362884 missense probably damaging 0.97
R6088:Plekhg2 UTSW 7 28361013 missense probably benign 0.01
R6912:Plekhg2 UTSW 7 28360259 missense probably benign 0.39
R7258:Plekhg2 UTSW 7 28364778 missense probably benign 0.00
R7530:Plekhg2 UTSW 7 28361928 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCGTTAATGTTGTTTTAATCAGGC -3'
(R):5'- AACCTGGGCCTGTCTCTATG -3'

Sequencing Primer
(F):5'- AGCCCAGGTTAGTCTTGAAC -3'
(R):5'- CTATGCCTGATGTGGTCCCAG -3'
Posted On2016-11-09