Incidental Mutation 'RF051:Plekhg2'
ID605143
Institutional Source Beutler Lab
Gene Symbol Plekhg2
Ensembl Gene ENSMUSG00000037552
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 2
SynonymsClg
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock #RF051 (G1)
Quality Score122.457
Status Not validated
Chromosome7
Chromosomal Location28359604-28372599 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GGTG to GG at 28362352 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094644] [ENSMUST00000119990] [ENSMUST00000121085] [ENSMUST00000144700]
Predicted Effect probably null
Transcript: ENSMUST00000094644
SMART Domains Protein: ENSMUSP00000092228
Gene: ENSMUSG00000037552

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
low complexity region 46 63 N/A INTRINSIC
low complexity region 73 88 N/A INTRINSIC
RhoGEF 103 279 3.98e-49 SMART
PH 305 410 3.01e-8 SMART
low complexity region 463 481 N/A INTRINSIC
low complexity region 582 605 N/A INTRINSIC
low complexity region 842 856 N/A INTRINSIC
low complexity region 1232 1246 N/A INTRINSIC
low complexity region 1268 1292 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119990
SMART Domains Protein: ENSMUSP00000112881
Gene: ENSMUSG00000037552

DomainStartEndE-ValueType
low complexity region 45 62 N/A INTRINSIC
low complexity region 72 87 N/A INTRINSIC
RhoGEF 102 278 3.98e-49 SMART
PH 304 409 3.01e-8 SMART
low complexity region 462 480 N/A INTRINSIC
low complexity region 581 604 N/A INTRINSIC
low complexity region 841 855 N/A INTRINSIC
low complexity region 1231 1245 N/A INTRINSIC
low complexity region 1267 1291 N/A INTRINSIC
low complexity region 1319 1333 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121085
SMART Domains Protein: ENSMUSP00000113449
Gene: ENSMUSG00000037552

DomainStartEndE-ValueType
low complexity region 45 62 N/A INTRINSIC
low complexity region 72 87 N/A INTRINSIC
RhoGEF 102 278 3.98e-49 SMART
PH 304 409 3.01e-8 SMART
low complexity region 462 479 N/A INTRINSIC
low complexity region 606 629 N/A INTRINSIC
low complexity region 866 880 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
low complexity region 1292 1316 N/A INTRINSIC
low complexity region 1344 1358 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000144700
SMART Domains Protein: ENSMUSP00000115651
Gene: ENSMUSG00000037552

DomainStartEndE-ValueType
low complexity region 45 62 N/A INTRINSIC
low complexity region 72 87 N/A INTRINSIC
RhoGEF 102 278 3.98e-49 SMART
PH 304 409 3.01e-8 SMART
low complexity region 462 480 N/A INTRINSIC
low complexity region 581 604 N/A INTRINSIC
low complexity region 841 855 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cnpy3 CTC CTCATC 17: 46,736,748 probably benign Het
Fam71e1 GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA 7: 44,500,523 probably null Het
Gabre CTCCGG CTCCGGGTCCGG X: 72,270,049 probably benign Het
Gm14399 G C 2: 175,131,201 Q254E probably benign Het
Hsdl2 TGC TGCCGGAGCAGCCACAGCGGC 4: 59,610,636 probably benign Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCAAAGCTGCAG 4: 59,610,650 probably benign Het
Il2 GGG GGGGCTTGAAGTGGG 3: 37,125,841 probably benign Het
Kmt2c CCTTCT CCT 5: 25,313,479 probably benign Het
Manbal CGATAGAAT C 2: 157,396,012 probably null Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,306,296 probably benign Het
Mei1 GC GCTGGCTGCC 15: 82,070,010 probably null Het
Nbea TTTA T 3: 56,009,212 probably benign Het
Nefh TGGCC TGGCCGCACCTGGGGCCTCGGCC 11: 4,941,054 probably benign Het
Olfr1535 GCCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTATGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT GGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT 13: 21,555,523 probably null Het
Pde3b GGTGGTGGTG GGTGGTGGTGGTG 7: 114,534,775 probably benign Het
Rassf6 AGCAATGGGGA AGCAATGGGGAATCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGA 5: 90,608,929 probably benign Het
Smarca2 AGCAGC AGCAGCCGCAGC 19: 26,630,988 probably benign Het
Stard8 GAG GAGCAG X: 99,066,524 probably benign Het
Tcof1 CTTGGC CTTGGCTGCTGAGATGGGCACTTTCCCAGAGATCCCATTGGC 18: 60,833,579 probably benign Het
Tmem28 GCCGCC GCCGCCACCGCC X: 99,821,362 probably benign Het
Triobp AGCCCCAGGACTCCCTGTGCCCAACGG AGCCCCAGGACTCCCTGTGCCCAACGGAACAGCCCCAGGACTCCCTGTGCCCAACGG 15: 78,967,034 probably benign Het
Usp2 C CTCATGTGACCTGTTCTTCACTTCT 9: 44,089,129 probably benign Het
Other mutations in Plekhg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Plekhg2 APN 7 28360869 nonsense probably null
IGL00933:Plekhg2 APN 7 28360689 missense probably benign 0.01
IGL02037:Plekhg2 APN 7 28368697 missense probably damaging 1.00
IGL02103:Plekhg2 APN 7 28360076 missense probably damaging 1.00
IGL02598:Plekhg2 APN 7 28360475 missense possibly damaging 0.55
IGL02892:Plekhg2 APN 7 28362917 missense probably damaging 1.00
IGL03249:Plekhg2 APN 7 28368002 missense probably damaging 1.00
R0561:Plekhg2 UTSW 7 28370483 missense probably benign
R1134:Plekhg2 UTSW 7 28362001 missense probably damaging 0.99
R1619:Plekhg2 UTSW 7 28368421 missense probably damaging 1.00
R2225:Plekhg2 UTSW 7 28360335 missense probably benign 0.02
R4043:Plekhg2 UTSW 7 28364719 unclassified probably benign
R4117:Plekhg2 UTSW 7 28360888 missense probably benign 0.02
R4296:Plekhg2 UTSW 7 28371166 missense probably damaging 1.00
R4956:Plekhg2 UTSW 7 28368355 missense probably damaging 1.00
R5376:Plekhg2 UTSW 7 28362669 missense probably damaging 0.99
R5378:Plekhg2 UTSW 7 28362669 missense probably damaging 0.99
R5523:Plekhg2 UTSW 7 28370431 missense probably damaging 1.00
R5545:Plekhg2 UTSW 7 28362461 missense probably damaging 1.00
R5667:Plekhg2 UTSW 7 28367639 missense probably damaging 1.00
R5913:Plekhg2 UTSW 7 28364602 missense probably damaging 0.99
R6017:Plekhg2 UTSW 7 28362884 missense probably damaging 0.97
R6088:Plekhg2 UTSW 7 28361013 missense probably benign 0.01
R6912:Plekhg2 UTSW 7 28360259 missense probably benign 0.39
R7258:Plekhg2 UTSW 7 28364778 missense probably benign 0.00
R7530:Plekhg2 UTSW 7 28361928 missense probably damaging 1.00
R8054:Plekhg2 UTSW 7 28365316 missense probably damaging 0.96
R8217:Plekhg2 UTSW 7 28368292 missense probably null 1.00
R8441:Plekhg2 UTSW 7 28360866 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- AGAATGACACGCCTTCTGTG -3'
(R):5'- ACAGATGAACGCGAGCCTTC -3'

Sequencing Primer
(F):5'- GACACGCCTTCTGTGTCATC -3'
(R):5'- ACTGCACGTCTTAGAGGGG -3'
Posted On2019-12-04