Incidental Mutation 'R5760:Atp10d'
ID445238
Institutional Source Beutler Lab
Gene Symbol Atp10d
Ensembl Gene ENSMUSG00000046808
Gene NameATPase, class V, type 10D
SynonymsIMAGE:1069176, 9830145H18Rik, D5Buc24e
MMRRC Submission 043362-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R5760 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location72203329-72298775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72260937 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 602 (V602E)
Ref Sequence ENSEMBL: ENSMUSP00000143594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126664]
Predicted Effect probably benign
Transcript: ENSMUST00000126664
AA Change: V602E

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143594
Gene: ENSMUSG00000046808
AA Change: V602E

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 111 176 1.2e-21 PFAM
Pfam:E1-E2_ATPase 181 450 3e-10 PFAM
low complexity region 523 534 N/A INTRINSIC
low complexity region 684 696 N/A INTRINSIC
Pfam:Cation_ATPase 739 859 3.4e-7 PFAM
Pfam:HAD 754 1114 1.3e-12 PFAM
Pfam:PhoLip_ATPase_C 1131 1376 4.3e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136350
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik T C 15: 37,439,591 probably benign Het
Abl2 C T 1: 156,641,857 T793M probably benign Het
Accs A C 2: 93,845,760 L90R probably damaging Het
Ahnak A T 19: 9,013,562 D4070V probably damaging Het
Apbb2 A G 5: 66,362,757 V475A probably benign Het
Cdh23 C T 10: 60,406,392 V1088M probably damaging Het
Dennd6a A T 14: 26,612,040 I144L probably damaging Het
Dnajc6 G A 4: 101,618,642 A571T probably benign Het
Drap1 A G 19: 5,424,363 I18T probably damaging Het
En2 C A 5: 28,166,999 A158D probably benign Het
Fbn1 C T 2: 125,361,247 G1219R probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm7535 C T 17: 17,911,818 probably benign Het
Hao2 A T 3: 98,880,432 L227* probably null Het
Hdlbp C T 1: 93,440,777 probably benign Het
Hivep3 A G 4: 120,095,011 K175E possibly damaging Het
Hmcn2 G A 2: 31,414,568 A3075T possibly damaging Het
Igkv6-15 A T 6: 70,406,532 I95N probably damaging Het
Itgad A T 7: 128,203,365 Q1001L probably benign Het
Jaml T A 9: 45,097,754 M151K probably benign Het
Lix1 T A 17: 17,427,237 V55D possibly damaging Het
Macf1 A G 4: 123,513,884 S179P probably damaging Het
Matn2 T A 15: 34,355,607 Q33L possibly damaging Het
Mcm3 CT CTT 1: 20,808,748 probably null Het
Mroh5 A C 15: 73,821,507 I28S probably damaging Het
Naip5 T G 13: 100,242,838 K231N probably damaging Het
Neb A C 2: 52,183,818 Y5683D probably damaging Het
Npc1l1 A T 11: 6,229,031 H126Q probably benign Het
Npm2 A G 14: 70,649,495 F110L probably damaging Het
Nsd3 A T 8: 25,659,756 H319L probably damaging Het
Nup205 G A 6: 35,247,343 R2039Q probably damaging Het
Olfr1406 C A 1: 173,183,751 A228S probably benign Het
Olfr1415 A G 1: 92,491,200 L185P possibly damaging Het
Olfr77 A C 9: 19,920,754 T182P probably benign Het
Pcdhac2 G A 18: 37,146,400 G811E probably damaging Het
Pkhd1 T A 1: 20,073,554 R3849S probably benign Het
Pmfbp1 A T 8: 109,521,023 D317V probably damaging Het
Sall1 T C 8: 89,028,650 N1234D possibly damaging Het
Slc12a7 T A 13: 73,813,622 V1037D probably damaging Het
Slc12a8 G T 16: 33,624,785 E404* probably null Het
Tchhl1 C G 3: 93,471,556 S522R probably damaging Het
Tgif1 A G 17: 70,845,001 V152A probably damaging Het
Tshz3 C A 7: 36,771,569 H994Q probably damaging Het
Ubash3b T G 9: 41,077,423 K62T probably benign Het
Ushbp1 G T 8: 71,387,368 D546E probably damaging Het
Zfp458 A C 13: 67,257,789 C192W probably damaging Het
Zfp808 A T 13: 62,171,926 H323L probably damaging Het
Other mutations in Atp10d
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1350:Atp10d UTSW 5 72261126 splice site probably benign
R3500:Atp10d UTSW 5 72245723 missense probably damaging 1.00
R3522:Atp10d UTSW 5 72239157 missense probably benign 0.01
R3833:Atp10d UTSW 5 72239225 missense possibly damaging 0.95
R4376:Atp10d UTSW 5 72296975 missense probably damaging 1.00
R4377:Atp10d UTSW 5 72296975 missense probably damaging 1.00
R4755:Atp10d UTSW 5 72246166 missense probably benign 0.04
R4828:Atp10d UTSW 5 72239118 missense probably benign 0.18
R5224:Atp10d UTSW 5 72269326 missense probably benign 0.03
R5289:Atp10d UTSW 5 72255123 missense probably benign 0.27
R5636:Atp10d UTSW 5 72288219 missense probably damaging 1.00
R5640:Atp10d UTSW 5 72247209 missense probably damaging 1.00
R5653:Atp10d UTSW 5 72264067 missense probably benign 0.21
R5681:Atp10d UTSW 5 72246946 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- GGGCCAACCTGTGTTATAGAG -3'
(R):5'- AATTTACCTTTTGCCGAGGTTG -3'

Sequencing Primer
(F):5'- AGCTCAGTAGTTACGAACCCTGG -3'
(R):5'- TTGGTTCGGTGCAGAAACCAC -3'
Posted On2016-11-21