Incidental Mutation 'R5781:Mc2r'
ID447758
Institutional Source Beutler Lab
Gene Symbol Mc2r
Ensembl Gene ENSMUSG00000045569
Gene Namemelanocortin 2 receptor
Synonymsadrenocorticotropic hormone receptor, Acthr
MMRRC Submission 043378-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5781 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location68406907-68429251 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68407395 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 276 (Y276N)
Ref Sequence ENSEMBL: ENSMUSP00000058691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052347]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052347
AA Change: Y276N

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000058691
Gene: ENSMUSG00000045569
AA Change: Y276N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 291 2.4e-13 PFAM
Pfam:7tm_1 41 276 1.1e-29 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MC2R encodes one member of the five-member G-protein associated melanocortin receptor family. Melanocortins (melanocyte-stimulating hormones and adrenocorticotropic hormone) are peptides derived from pro-opiomelanocortin (POMC). MC2R is selectively activated by adrenocorticotropic hormone, whereas the other four melanocortin receptors recognize a variety of melanocortin ligands. Mutations in MC2R can result in familial glucocorticoid deficiency. Alternate transcript variants have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality due to impaired gluconeogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,101,987 L1617P probably damaging Het
Abhd16b T C 2: 181,494,154 V283A probably damaging Het
Adamts19 G T 18: 58,837,968 R208L possibly damaging Het
Adamts4 T C 1: 171,251,015 I56T possibly damaging Het
Alpk1 A C 3: 127,680,035 V773G possibly damaging Het
Arhgap10 G T 8: 77,450,707 Q100K possibly damaging Het
Arhgef18 T A 8: 3,439,439 probably null Het
Asb15 A T 6: 24,564,378 H277L probably benign Het
Ascc3 T A 10: 50,637,978 V291E probably damaging Het
Cnot6l A C 5: 96,086,165 V329G probably benign Het
Col14a1 A G 15: 55,423,512 T910A unknown Het
Dhdds G A 4: 133,996,830 L58F probably damaging Het
Dsc2 A G 18: 20,032,510 I846T probably benign Het
Evc A T 5: 37,326,570 S129T probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fyco1 A G 9: 123,794,833 V1377A probably damaging Het
Haus6 C T 4: 86,601,263 A203T possibly damaging Het
Hkdc1 T G 10: 62,417,933 D23A probably damaging Het
Hpdl C T 4: 116,820,578 V229M probably damaging Het
Hspa12a T C 19: 58,822,086 Y175C probably damaging Het
Hyal1 C T 9: 107,577,667 P59S probably damaging Het
Itpr1 G A 6: 108,510,738 C2374Y probably benign Het
Kmt2a A T 9: 44,847,842 Y114* probably null Het
Mlycd A G 8: 119,410,280 Y413C probably damaging Het
Mocs2 T G 13: 114,820,919 S86R probably damaging Het
Msx2 C A 13: 53,472,608 A35S probably benign Het
Olfr770 A T 10: 129,133,147 L207H probably damaging Het
Pla2g4f C A 2: 120,305,023 S390I probably damaging Het
Plcl1 C T 1: 55,695,989 A163V possibly damaging Het
Pnn T C 12: 59,071,819 V396A probably damaging Het
Rbmxl1 G A 8: 78,505,641 probably benign Het
Recql G T 6: 142,365,618 probably null Het
Rev3l T A 10: 39,823,093 N1195K probably benign Het
Rfwd3 G A 8: 111,273,084 T754M probably benign Het
Sctr A G 1: 120,031,620 T98A probably damaging Het
Sdk1 T A 5: 141,936,048 D6E probably benign Het
Smpdl3a T A 10: 57,807,938 I264K possibly damaging Het
Spag6 A G 2: 18,731,993 I154V probably benign Het
Tbc1d12 A C 19: 38,882,683 T297P probably benign Het
Tgfb1 A G 7: 25,696,960 D226G probably benign Het
Ubr3 G T 2: 70,016,244 probably null Het
Ubr4 T C 4: 139,468,096 Y1210H probably damaging Het
Ubr5 T C 15: 38,006,541 T1157A probably benign Het
Vmn2r120 T G 17: 57,524,938 T284P probably benign Het
Vps13b G T 15: 35,794,035 A2286S probably damaging Het
Zcchc14 A T 8: 121,604,593 probably benign Het
Zfr2 T A 10: 81,243,713 V362E probably benign Het
Other mutations in Mc2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01654:Mc2r APN 18 68408072 missense probably benign 0.07
IGL01866:Mc2r APN 18 68407423 missense possibly damaging 0.81
IGL02002:Mc2r APN 18 68407434 missense probably benign 0.00
PIT4366001:Mc2r UTSW 18 68407755 missense probably benign
R0276:Mc2r UTSW 18 68408132 missense possibly damaging 0.69
R1061:Mc2r UTSW 18 68407809 missense probably damaging 1.00
R1085:Mc2r UTSW 18 68407346 missense probably benign
R1610:Mc2r UTSW 18 68407448 missense probably damaging 1.00
R1688:Mc2r UTSW 18 68408019 missense possibly damaging 0.68
R1930:Mc2r UTSW 18 68407782 missense probably benign 0.00
R2184:Mc2r UTSW 18 68408125 missense probably benign 0.02
R2397:Mc2r UTSW 18 68408153 missense probably benign 0.00
R4913:Mc2r UTSW 18 68407340 missense probably benign
R5087:Mc2r UTSW 18 68408203 missense probably benign 0.01
R5506:Mc2r UTSW 18 68407948 nonsense probably null
R5781:Mc2r UTSW 18 68407397 missense probably damaging 1.00
R6364:Mc2r UTSW 18 68407536 missense probably benign 0.00
R7908:Mc2r UTSW 18 68407965 missense probably benign 0.00
R7989:Mc2r UTSW 18 68407965 missense probably benign 0.00
Z1177:Mc2r UTSW 18 68407712 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GGCAGTTATGGTAAACACTAGTCAG -3'
(R):5'- GGAAGATCTCTACCCTTCCTAGAAC -3'

Sequencing Primer
(F):5'- AGTGGGACTGAACTACTGGTC -3'
(R):5'- CTTCCTAGAACCAACATGAAGGGTG -3'
Posted On2016-12-15