Incidental Mutation 'R5705:Arhgap4'
ID451950
Institutional Source Beutler Lab
Gene Symbol Arhgap4
Ensembl Gene ENSMUSG00000031389
Gene NameRho GTPase activating protein 4
SynonymsA530015A20Rik, A130009C12Rik, Rgc1, c1
MMRRC Submission 043330-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5705 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location73891442-73921870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73906817 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 43 (R43W)
Ref Sequence ENSEMBL: ENSMUSP00000117602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064376] [ENSMUST00000114404] [ENSMUST00000114405] [ENSMUST00000114406] [ENSMUST00000114407] [ENSMUST00000123283] [ENSMUST00000124798] [ENSMUST00000130976] [ENSMUST00000140393]
Predicted Effect probably damaging
Transcript: ENSMUST00000064376
AA Change: R43W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067477
Gene: ENSMUSG00000031389
AA Change: R43W

DomainStartEndE-ValueType
FCH 22 125 5.81e-21 SMART
coiled coil region 144 172 N/A INTRINSIC
low complexity region 203 218 N/A INTRINSIC
low complexity region 316 323 N/A INTRINSIC
low complexity region 392 402 N/A INTRINSIC
low complexity region 419 430 N/A INTRINSIC
low complexity region 433 449 N/A INTRINSIC
RhoGAP 529 703 4.11e-59 SMART
SH3 760 815 4.28e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114404
AA Change: R43W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110046
Gene: ENSMUSG00000031389
AA Change: R43W

DomainStartEndE-ValueType
FCH 22 125 5.81e-21 SMART
coiled coil region 144 172 N/A INTRINSIC
low complexity region 203 218 N/A INTRINSIC
low complexity region 316 323 N/A INTRINSIC
low complexity region 392 402 N/A INTRINSIC
low complexity region 419 430 N/A INTRINSIC
low complexity region 433 449 N/A INTRINSIC
RhoGAP 529 692 7.02e-44 SMART
SH3 749 804 4.28e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114405
AA Change: R43W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110047
Gene: ENSMUSG00000031389
AA Change: R43W

DomainStartEndE-ValueType
FCH 22 125 5.81e-21 SMART
low complexity region 150 166 N/A INTRINSIC
low complexity region 213 228 N/A INTRINSIC
low complexity region 326 333 N/A INTRINSIC
low complexity region 402 412 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
low complexity region 443 459 N/A INTRINSIC
RhoGAP 539 713 4.11e-59 SMART
SH3 770 825 4.28e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114406
AA Change: R43W

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110048
Gene: ENSMUSG00000031389
AA Change: R43W

DomainStartEndE-ValueType
FCH 22 125 5.81e-21 SMART
coiled coil region 149 172 N/A INTRINSIC
low complexity region 204 214 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 245 261 N/A INTRINSIC
RhoGAP 341 515 4.11e-59 SMART
SH3 572 627 4.28e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114407
AA Change: R43W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110049
Gene: ENSMUSG00000031389
AA Change: R43W

DomainStartEndE-ValueType
FCH 22 125 5.81e-21 SMART
low complexity region 182 197 N/A INTRINSIC
low complexity region 295 302 N/A INTRINSIC
low complexity region 371 381 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
RhoGAP 508 682 4.11e-59 SMART
SH3 739 794 4.28e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123283
Predicted Effect probably benign
Transcript: ENSMUST00000124798
SMART Domains Protein: ENSMUSP00000121215
Gene: ENSMUSG00000031389

DomainStartEndE-ValueType
low complexity region 80 87 N/A INTRINSIC
low complexity region 155 166 N/A INTRINSIC
low complexity region 169 185 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128329
Predicted Effect probably damaging
Transcript: ENSMUST00000130976
AA Change: R43W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120650
Gene: ENSMUSG00000031389
AA Change: R43W

DomainStartEndE-ValueType
FCH 22 125 5.81e-21 SMART
coiled coil region 144 172 N/A INTRINSIC
low complexity region 203 218 N/A INTRINSIC
low complexity region 316 323 N/A INTRINSIC
low complexity region 392 402 N/A INTRINSIC
low complexity region 419 430 N/A INTRINSIC
low complexity region 433 449 N/A INTRINSIC
RhoGAP 529 703 4.11e-59 SMART
SH3 760 815 4.28e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000140393
AA Change: R43W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117602
Gene: ENSMUSG00000031389
AA Change: R43W

DomainStartEndE-ValueType
FCH 22 125 5.81e-21 SMART
coiled coil region 144 172 N/A INTRINSIC
low complexity region 203 218 N/A INTRINSIC
low complexity region 316 323 N/A INTRINSIC
low complexity region 392 402 N/A INTRINSIC
low complexity region 419 430 N/A INTRINSIC
low complexity region 433 449 N/A INTRINSIC
coiled coil region 461 493 N/A INTRINSIC
SCOP:d1tx4a_ 513 590 3e-10 SMART
Blast:RhoGAP 529 590 3e-35 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151600
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the rhoGAP family of proteins which play a role in the regulation of small GTP-binding proteins belonging to the RAS superfamily. The protein encoded by the orthologous gene in rat is localized to the Golgi complex and can redistribute to microtubules. The rat protein stimulates the activity of some Rho GTPases in vitro. Genomic deletions of this gene and a neighboring gene have been found in patients with nephrogenic diabetes insipidus. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,442 V2163A probably benign Het
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Ago1 T C 4: 126,448,794 I519V probably benign Het
Aurkb T A 11: 69,048,815 L213I possibly damaging Het
Bod1l T A 5: 41,817,002 Q2323L probably benign Het
Ccdc17 C T 4: 116,596,869 T28I probably benign Het
Ccdc39 T C 3: 33,816,937 E630G probably damaging Het
Cnih4 A G 1: 181,153,735 I24V probably benign Het
Ctse C A 1: 131,664,374 T146K possibly damaging Het
Ctsr A G 13: 61,161,264 F226L probably damaging Het
Cyp2a22 T C 7: 26,939,215 N49D probably benign Het
Defb23 C T 2: 152,459,284 A123T probably benign Het
Dtx2 C A 5: 136,010,295 D69E probably damaging Het
Eps8l1 T C 7: 4,470,035 V91A probably benign Het
Eps8l3 C A 3: 107,891,264 Q489K probably benign Het
Esyt3 A G 9: 99,318,207 S645P probably benign Het
Fam161a T A 11: 23,028,869 M472K unknown Het
Fam196b A G 11: 34,404,349 Y473C probably damaging Het
Fam26e A T 10: 34,095,993 C149S probably damaging Het
Glp2r A G 11: 67,709,739 V428A probably benign Het
Gnl1 G A 17: 35,981,600 V191I probably benign Het
Hfm1 T C 5: 106,911,453 I234M probably benign Het
Hlx T C 1: 184,730,865 T197A probably benign Het
Hs3st2 T C 7: 121,393,082 L85P probably damaging Het
Igsf9 T C 1: 172,494,771 V511A possibly damaging Het
Kcnma1 A T 14: 24,003,771 C54S possibly damaging Het
Klhdc4 A G 8: 121,804,993 V181A probably benign Het
Ldb3 T C 14: 34,577,029 M213V probably null Het
Mertk C A 2: 128,771,401 Q446K probably benign Het
Ndufs1 A G 1: 63,147,158 V46A probably benign Het
Neurod4 A G 10: 130,271,402 M1T probably null Het
Nlrc5 T A 8: 94,475,757 C162S probably benign Het
Pald1 A G 10: 61,323,297 I785T possibly damaging Het
Pcmt1 T C 10: 7,638,190 I224M possibly damaging Het
Pisd C T 5: 32,737,363 R533H probably benign Het
Plcxd3 C A 15: 4,517,194 Q227K probably benign Het
Polr1b A T 2: 129,105,351 K199* probably null Het
Ppp1r10 T C 17: 35,929,489 V557A probably damaging Het
Ralgapa2 A G 2: 146,449,273 Y248H probably damaging Het
Rsrp1 T C 4: 134,924,020 S32P unknown Het
Setdb2 T G 14: 59,423,365 S110R possibly damaging Het
Srcin1 A G 11: 97,548,951 C152R probably benign Het
Syk A G 13: 52,611,047 N70S probably benign Het
Tlr4 T A 4: 66,833,980 D59E probably damaging Het
Tm9sf4 T A 2: 153,182,458 I67N probably benign Het
Trim30b T A 7: 104,357,577 Y24F probably damaging Het
Tsga13 A G 6: 30,900,016 S189P probably damaging Het
Tspan33 A G 6: 29,717,233 D210G probably benign Het
Use1 G T 8: 71,369,687 R278L probably damaging Het
Wwc1 T C 11: 35,876,596 N403D probably damaging Het
Zfp263 C T 16: 3,746,454 P203S probably benign Het
Other mutations in Arhgap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Arhgap4 APN X 73900093 unclassified probably benign
IGL02868:Arhgap4 APN X 73900402 missense probably benign 0.01
R0603:Arhgap4 UTSW X 73906783 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCAGACCAAGGAGCCTAGG -3'
(R):5'- TTAGCTCAGTCAGGTGCCAG -3'

Sequencing Primer
(F):5'- CCTGCAAGGCACTACTGCTAG -3'
(R):5'- CCAGGGAGCCTTTGGTGTAGAC -3'
Posted On2017-01-03