Mutagenetix > Incidental Mutation

Incidental Mutation 'R5705:Setdb2'

451945

Institutional Source

Beutler Lab

Gene Symbol

Setdb2

Ensembl Gene

ENSMUSG00000071350

Gene Name

SET domain, bifurcated 2

Synonyms

KMT1F, LOC239122

MMRRC Submission

043330-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.510) question?

Stock #

R5705 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59402009-59440884 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 59423365 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 110 (S110R)

Ref Sequence

ENSEMBL: ENSMUSP00000106884 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000111253] [ENSMUST00000161459]

AlphaFold

Q8C267

Predicted Effect

probably benign
Transcript: ENSMUST00000095775

SMART Domains

Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350

Domain	Start	End	E-Value	Type
Pfam:MBD	164	236	3.4e-10	PFAM
Pfam:Pre-SET	250	362	1.7e-17	PFAM
SET	370	694	9.33e-32	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111253
AA Change: S110R

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000161459

SMART Domains

Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350

Domain	Start	End	E-Value	Type
Pfam:MBD	148	220	2.7e-9	PFAM
Pfam:Pre-SET	233	346	1.3e-19	PFAM
SET	354	678	9.33e-32	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	T	C	10: 80,015,442	V2163A	probably benign	Het
Abcg3	G	A	5: 104,968,170	A266V	probably damaging	Het
Ago1	T	C	4: 126,448,794	I519V	probably benign	Het
Arhgap4	G	A	X: 73,906,817	R43W	probably damaging	Het
Aurkb	T	A	11: 69,048,815	L213I	possibly damaging	Het
Bod1l	T	A	5: 41,817,002	Q2323L	probably benign	Het
Ccdc17	C	T	4: 116,596,869	T28I	probably benign	Het
Ccdc39	T	C	3: 33,816,937	E630G	probably damaging	Het
Cnih4	A	G	1: 181,153,735	I24V	probably benign	Het
Ctse	C	A	1: 131,664,374	T146K	possibly damaging	Het
Ctsr	A	G	13: 61,161,264	F226L	probably damaging	Het
Cyp2a22	T	C	7: 26,939,215	N49D	probably benign	Het
Defb23	C	T	2: 152,459,284	A123T	probably benign	Het
Dtx2	C	A	5: 136,010,295	D69E	probably damaging	Het
Eps8l1	T	C	7: 4,470,035	V91A	probably benign	Het
Eps8l3	C	A	3: 107,891,264	Q489K	probably benign	Het
Esyt3	A	G	9: 99,318,207	S645P	probably benign	Het
Fam161a	T	A	11: 23,028,869	M472K	unknown	Het
Fam196b	A	G	11: 34,404,349	Y473C	probably damaging	Het
Fam26e	A	T	10: 34,095,993	C149S	probably damaging	Het
Glp2r	A	G	11: 67,709,739	V428A	probably benign	Het
Gnl1	G	A	17: 35,981,600	V191I	probably benign	Het
Hfm1	T	C	5: 106,911,453	I234M	probably benign	Het
Hlx	T	C	1: 184,730,865	T197A	probably benign	Het
Hs3st2	T	C	7: 121,393,082	L85P	probably damaging	Het
Igsf9	T	C	1: 172,494,771	V511A	possibly damaging	Het
Kcnma1	A	T	14: 24,003,771	C54S	possibly damaging	Het
Klhdc4	A	G	8: 121,804,993	V181A	probably benign	Het
Ldb3	T	C	14: 34,577,029	M213V	probably null	Het
Mertk	C	A	2: 128,771,401	Q446K	probably benign	Het
Ndufs1	A	G	1: 63,147,158	V46A	probably benign	Het
Neurod4	A	G	10: 130,271,402	M1T	probably null	Het
Nlrc5	T	A	8: 94,475,757	C162S	probably benign	Het
Pald1	A	G	10: 61,323,297	I785T	possibly damaging	Het
Pcmt1	T	C	10: 7,638,190	I224M	possibly damaging	Het
Pisd	C	T	5: 32,737,363	R533H	probably benign	Het
Plcxd3	C	A	15: 4,517,194	Q227K	probably benign	Het
Polr1b	A	T	2: 129,105,351	K199*	probably null	Het
Ppp1r10	T	C	17: 35,929,489	V557A	probably damaging	Het
Ralgapa2	A	G	2: 146,449,273	Y248H	probably damaging	Het
Rsrp1	T	C	4: 134,924,020	S32P	unknown	Het
Srcin1	A	G	11: 97,548,951	C152R	probably benign	Het
Syk	A	G	13: 52,611,047	N70S	probably benign	Het
Tlr4	T	A	4: 66,833,980	D59E	probably damaging	Het
Tm9sf4	T	A	2: 153,182,458	I67N	probably benign	Het
Trim30b	T	A	7: 104,357,577	Y24F	probably damaging	Het
Tsga13	A	G	6: 30,900,016	S189P	probably damaging	Het
Tspan33	A	G	6: 29,717,233	D210G	probably benign	Het
Use1	G	T	8: 71,369,687	R278L	probably damaging	Het
Wwc1	T	C	11: 35,876,596	N403D	probably damaging	Het
Zfp263	C	T	16: 3,746,454	P203S	probably benign	Het

Other mutations in Setdb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Setdb2	APN	14	59415792	missense	probably damaging	1.00
IGL01695:Setdb2	APN	14	59402293	utr 3 prime	probably benign
IGL01720:Setdb2	APN	14	59423436	missense	possibly damaging	0.76
IGL02003:Setdb2	APN	14	59413490	missense	probably damaging	0.98
IGL02023:Setdb2	APN	14	59431158	missense	probably damaging	1.00
IGL02108:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02113:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02114:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02115:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02116:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02117:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02141:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02148:Setdb2	APN	14	59402315	missense	probably damaging	1.00
R0419:Setdb2	UTSW	14	59406744	splice site	probably null
R0610:Setdb2	UTSW	14	59417470	missense	possibly damaging	0.55
R0636:Setdb2	UTSW	14	59406704	missense	probably benign	0.40
R0890:Setdb2	UTSW	14	59419220	missense	possibly damaging	0.89
R0931:Setdb2	UTSW	14	59423496	splice site	probably benign
R1355:Setdb2	UTSW	14	59417441	missense	probably damaging	1.00
R1553:Setdb2	UTSW	14	59417485	missense	probably benign	0.04
R1968:Setdb2	UTSW	14	59419409	missense	probably damaging	1.00
R2472:Setdb2	UTSW	14	59419454	missense	possibly damaging	0.49
R2894:Setdb2	UTSW	14	59426467	missense	probably benign	0.00
R3919:Setdb2	UTSW	14	59419167	missense	probably damaging	1.00
R4609:Setdb2	UTSW	14	59415704	missense	probably damaging	1.00
R4629:Setdb2	UTSW	14	59409359	missense	probably benign	0.13
R4816:Setdb2	UTSW	14	59413646	missense	probably benign	0.05
R4864:Setdb2	UTSW	14	59409266	missense	probably benign	0.01
R4951:Setdb2	UTSW	14	59402303	missense	possibly damaging	0.72
R5040:Setdb2	UTSW	14	59415707	missense	probably damaging	0.99
R5245:Setdb2	UTSW	14	59426494	missense	probably null	0.00
R5358:Setdb2	UTSW	14	59409436	missense	probably benign	0.17
R5656:Setdb2	UTSW	14	59419118	missense	probably damaging	1.00
R6103:Setdb2	UTSW	14	59409532	splice site	probably null
R6106:Setdb2	UTSW	14	59423449	nonsense	probably null
R6388:Setdb2	UTSW	14	59424697	missense	probably benign
R6431:Setdb2	UTSW	14	59419056	missense	probably damaging	1.00
R6494:Setdb2	UTSW	14	59402414	missense	probably benign	0.12
R6971:Setdb2	UTSW	14	59415740	missense	probably damaging	1.00
R7442:Setdb2	UTSW	14	59419251	missense	probably damaging	0.99
R7444:Setdb2	UTSW	14	59423345	nonsense	probably null
R7759:Setdb2	UTSW	14	59419364	missense	probably damaging	1.00
R8021:Setdb2	UTSW	14	59423384	nonsense	probably null
R8039:Setdb2	UTSW	14	59402375	missense	probably damaging	1.00
R8261:Setdb2	UTSW	14	59413692	splice site	probably benign
R8393:Setdb2	UTSW	14	59412731	missense	probably benign	0.04
R8513:Setdb2	UTSW	14	59402390	missense	probably damaging	1.00
R8700:Setdb2	UTSW	14	59417439	missense	probably damaging	1.00
R8707:Setdb2	UTSW	14	59423458	nonsense	probably null
R8940:Setdb2	UTSW	14	59409507	missense	probably damaging	1.00
R9217:Setdb2	UTSW	14	59409432	missense	possibly damaging	0.61
R9314:Setdb2	UTSW	14	59412791	missense	probably benign	0.02
R9336:Setdb2	UTSW	14	59423367	missense	unknown
R9442:Setdb2	UTSW	14	59402400	missense	probably damaging	1.00
R9525:Setdb2	UTSW	14	59409392	missense	probably benign	0.00
R9743:Setdb2	UTSW	14	59413553	missense	probably benign	0.00
X0017:Setdb2	UTSW	14	59419468	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAAGCTTCGCCTCATATTTGC -3'
(R):5'- GGGCAGAATTTCTAGTCAGTGAG -3'

Sequencing Primer
(F):5'- GCTATTTTACAGGATGATGTAGACAC -3'
(R):5'- ACACCTGTGACTCAGAGT -3'

Posted On

2017-01-03