Mutagenetix > Incidental Mutation

Incidental Mutation 'IGL03054:Mrpl15'

453005

Institutional Source

Beutler Lab

Gene Symbol

Mrpl15

Ensembl Gene

ENSMUSG00000033845

Gene Name

mitochondrial ribosomal protein L15

Synonyms

HSPC145, MRP-L7, Rpml7

Accession Numbers

Essential gene?

Probably essential (E-score: 0.957) question?

Stock #

IGL03054 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

4843429-4855962 bp(-) (GRCm39)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 4855794 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000115512 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045689] [ENSMUST00000045689] [ENSMUST00000130201] [ENSMUST00000130201] [ENSMUST00000130201] [ENSMUST00000130201] [ENSMUST00000146665] [ENSMUST00000146665] [ENSMUST00000146665] [ENSMUST00000146665] [ENSMUST00000156816] [ENSMUST00000156816] [ENSMUST00000156816] [ENSMUST00000156816]

AlphaFold

Q9CPR5

Predicted Effect

probably benign
Transcript: ENSMUST00000045689

Predicted Effect

probably benign
Transcript: ENSMUST00000045689

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000115538

Predicted Effect

probably null
Transcript: ENSMUST00000130201

SMART Domains

Protein: ENSMUSP00000114649
Gene: ENSMUSG00000033845

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L18e	42	176	4.8e-14	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000130201

SMART Domains

Protein: ENSMUSP00000114649
Gene: ENSMUSG00000033845

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L18e	42	176	4.8e-14	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000130201

SMART Domains

Protein: ENSMUSP00000114649
Gene: ENSMUSG00000033845

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L18e	42	176	4.8e-14	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000130201

SMART Domains

Protein: ENSMUSP00000114649
Gene: ENSMUSG00000033845

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L18e	42	176	4.8e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132625

Predicted Effect

probably null
Transcript: ENSMUST00000146665

SMART Domains

Protein: ENSMUSP00000141204
Gene: ENSMUSG00000033845

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L18e	42	126	6.2e-9	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000146665

SMART Domains

Protein: ENSMUSP00000141204
Gene: ENSMUSG00000033845

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L18e	42	126	6.2e-9	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000146665

SMART Domains

Protein: ENSMUSP00000141204
Gene: ENSMUSG00000033845

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L18e	42	126	6.2e-9	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000146665

SMART Domains

Protein: ENSMUSP00000141204
Gene: ENSMUSG00000033845

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L18e	42	126	6.2e-9	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000156816

SMART Domains

Protein: ENSMUSP00000115512
Gene: ENSMUSG00000033845

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L18e	44	175	5e-29	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000156816

SMART Domains

Protein: ENSMUSP00000115512
Gene: ENSMUSG00000033845

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L18e	44	175	5e-29	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000156816

SMART Domains

Protein: ENSMUSP00000115512
Gene: ENSMUSG00000033845

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L18e	44	175	5e-29	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000156816

SMART Domains

Protein: ENSMUSP00000115512
Gene: ENSMUSG00000033845

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L18e	44	175	5e-29	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192286

Meta Mutation Damage Score

0.9497

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

98% (43/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein that belongs to the EcoL15 ribosomal protein family. A pseudogene corresponding to this gene is found on chromosome 15q. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933416I08Rik	TCC	TCCC	X: 52,692,862 (GRCm39)		noncoding transcript	Het
Acsbg3	A	G	17: 57,193,528 (GRCm39)	T625A	possibly damaging	Het
Aloxe3	T	C	11: 69,020,433 (GRCm39)	V159A	possibly damaging	Het
Atp13a2	T	A	4: 140,734,279 (GRCm39)	C1134S	possibly damaging	Het
Ccdc40	G	A	11: 119,154,027 (GRCm39)	E1100K	possibly damaging	Het
Ceacam5	A	T	7: 17,493,379 (GRCm39)	T801S	possibly damaging	Het
Cilp	TGGG	TGG	9: 65,187,412 (GRCm39)		probably null	Het
Col4a2	T	C	8: 11,498,270 (GRCm39)	I1693T	probably damaging	Het
Crb1	CG	C	1: 139,164,824 (GRCm39)		probably null	Het
Dab2	G	T	15: 6,447,707 (GRCm39)		probably benign	Het
Dao	T	C	5: 114,162,963 (GRCm39)	L345P	probably damaging	Het
Dis3l	A	G	9: 64,217,722 (GRCm39)		probably null	Het
Egr3	C	T	14: 70,316,561 (GRCm39)	T124M	probably damaging	Het
Gng7	G	T	10: 80,787,485 (GRCm39)	F59L	probably damaging	Het
Itgb4	C	A	11: 115,891,166 (GRCm39)	Y1190*	probably null	Het
Lacc1	T	C	14: 77,268,355 (GRCm39)	M319V	possibly damaging	Het
Mapkbp1	A	G	2: 119,845,881 (GRCm39)	T417A	probably damaging	Het
Mier3	C	T	13: 111,822,848 (GRCm39)		probably benign	Het
Mlxipl	A	G	5: 135,162,110 (GRCm39)	D569G	possibly damaging	Het
Mmp1a	TG	TGG	9: 7,465,083 (GRCm38)		probably null	Het
Neb	T	C	2: 52,161,334 (GRCm39)	N2153D	probably damaging	Het
Nlrp9c	A	G	7: 26,081,701 (GRCm39)		probably null	Het
Npepps	C	T	11: 97,132,614 (GRCm39)		probably benign	Het
Or13a17	T	G	7: 140,271,623 (GRCm39)	S268R	probably benign	Het
Or1j10	A	T	2: 36,266,944 (GRCm39)	H52L	possibly damaging	Het
Or52z12	C	A	7: 103,234,047 (GRCm39)	H273N	probably benign	Het
Psmc4	T	C	7: 27,746,605 (GRCm39)	Y160C	probably damaging	Het
Rims1	T	C	1: 22,360,333 (GRCm39)	Y131C	probably damaging	Het
Riok1	G	A	13: 38,231,291 (GRCm39)	G183D	probably damaging	Het
Samd9l	T	A	6: 3,376,023 (GRCm39)	I413F	probably damaging	Het
Tnfrsf22	A	G	7: 143,194,532 (GRCm39)	Y132H	probably damaging	Het
Ttn	T	A	2: 76,726,104 (GRCm39)		probably benign	Het
Tulp1	A	G	17: 28,578,287 (GRCm39)		probably benign	Het
Usp15	C	A	10: 122,961,836 (GRCm39)		probably benign	Het
Wdr7	G	T	18: 63,958,192 (GRCm39)		probably benign	Het

Other mutations in Mrpl15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01470:Mrpl15	APN	1	4,846,754 (GRCm39)	missense	probably damaging	1.00
IGL02307:Mrpl15	APN	1	4,854,176 (GRCm39)	missense	possibly damaging	0.82
IGL02390:Mrpl15	APN	1	4,855,837 (GRCm39)	missense	probably benign	0.01
R0730:Mrpl15	UTSW	1	4,847,834 (GRCm39)	missense	probably damaging	1.00
R1938:Mrpl15	UTSW	1	4,847,805 (GRCm39)	missense	probably damaging	0.99
R4855:Mrpl15	UTSW	1	4,844,683 (GRCm39)	missense	probably benign	0.05
R5025:Mrpl15	UTSW	1	4,854,368 (GRCm39)	intron	probably benign
R5951:Mrpl15	UTSW	1	4,855,956 (GRCm39)	utr 5 prime	probably benign
R6723:Mrpl15	UTSW	1	4,852,789 (GRCm39)	critical splice donor site	probably null
R6802:Mrpl15	UTSW	1	4,846,953 (GRCm39)	missense	probably benign	0.03
R6988:Mrpl15	UTSW	1	4,852,883 (GRCm39)	missense	probably benign	0.10
R7057:Mrpl15	UTSW	1	4,846,865 (GRCm39)	missense	probably benign
R7236:Mrpl15	UTSW	1	4,846,711 (GRCm39)	missense	probably benign
R7573:Mrpl15	UTSW	1	4,847,778 (GRCm39)	missense	probably damaging	0.98
R7934:Mrpl15	UTSW	1	4,844,725 (GRCm39)	missense	probably benign
R8830:Mrpl15	UTSW	1	4,852,807 (GRCm39)	missense	probably damaging	1.00
R9287:Mrpl15	UTSW	1	4,846,856 (GRCm39)	missense	probably damaging	1.00
R9531:Mrpl15	UTSW	1	4,847,757 (GRCm39)	missense	probably benign	0.24

Predicted Primers

PCR Primer
(F):5'- AGGCACTTGCTAAGCAGTTCAG -3'
(R):5'- GGAAGACATAGCCTACCGAC -3'

Sequencing Primer
(F):5'- GCTAAGCAGTTCAGTTTAAACGC -3'
(R):5'- TCTGCAGCACGACAGGG -3'

Posted On

2017-01-24