Mutagenetix > Incidental Mutation

Incidental Mutation 'IGL03138:Cilp'

453079

Institutional Source

Beutler Lab

Gene Symbol

Cilp

Ensembl Gene

ENSMUSG00000042254

Gene Name

cartilage intermediate layer protein, nucleotide pyrophosphohydrolase

Synonyms

C130036G17Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

IGL03138 (G1)

Quality Score

214

Status

Validated

Chromosome

Chromosomal Location

65172462-65187887 bp(+) (GRCm39)

Type of Mutation

frame shift

DNA Base Change (assembly)

TGGG to TGG at 65187412 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000036631 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048762] [ENSMUST00000141382]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000048762

SMART Domains

Protein: ENSMUSP00000036631
Gene: ENSMUSG00000042254

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Mucin2_WxxW	55	139	1.9e-24	PFAM
TSP1	152	201	3.09e-10	SMART
low complexity region	233	242	N/A	INTRINSIC
IGc2	321	383	4.45e-10	SMART
low complexity region	1154	1170	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141382

SMART Domains

Protein: ENSMUSP00000121326
Gene: ENSMUSG00000042254

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Major alterations in the composition of the cartilage extracellular matrix occur in joint disease, such as osteoarthrosis. This gene encodes the cartilage intermediate layer protein (CILP), which increases in early osteoarthrosis cartilage. The encoded protein was thought to encode a protein precursor for two different proteins; an N-terminal CILP and a C-terminal homolog of NTPPHase, however, later studies identified no nucleotide pyrophosphatase phosphodiesterase (NPP) activity. The full-length and the N-terminal domain of this protein was shown to function as an IGF-1 antagonist. An allelic variant of this gene has been associated with lumbar disc disease. [provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933416I08Rik	TCC	TCCC	X: 52,692,862 (GRCm39)		noncoding transcript	Het
Casd1	A	G	6: 4,613,236 (GRCm39)	H118R	probably damaging	Het
Cmya5	T	C	13: 93,201,850 (GRCm39)	K3371E	probably damaging	Het
Crb1	CG	C	1: 139,164,824 (GRCm39)		probably null	Het
Dpysl3	T	C	18: 43,458,859 (GRCm39)	T632A	probably benign	Het
Elapor1	T	A	3: 108,379,309 (GRCm39)	N392Y	probably benign	Het
Fbh1	T	C	2: 11,754,320 (GRCm39)		probably benign	Het
Fcna	G	C	2: 25,520,693 (GRCm39)		probably benign	Het
Gbe1	T	A	16: 70,325,951 (GRCm39)		probably benign	Het
Gm4876	T	G	6: 17,171,736 (GRCm39)		noncoding transcript	Het
Gvin-ps6	G	T	7: 106,023,650 (GRCm39)		noncoding transcript	Het
Hsd17b7	C	T	1: 169,780,649 (GRCm39)	E320K	probably damaging	Het
Inhba	T	A	13: 16,192,099 (GRCm39)	D73E	probably benign	Het
Kndc1	A	G	7: 139,519,791 (GRCm39)	N1717D	possibly damaging	Het
Knl1	G	T	2: 118,902,840 (GRCm39)	V1514F	probably damaging	Het
Map1b	C	T	13: 99,562,334 (GRCm39)	A2459T	unknown	Het
Mmp1a	TG	TGG	9: 7,465,083 (GRCm38)		probably null	Het
Pias2	T	C	18: 77,237,796 (GRCm39)		probably null	Het
Polr1b	T	C	2: 128,944,908 (GRCm39)	F68S	probably benign	Het
Skic8	T	C	9: 54,635,447 (GRCm39)		probably benign	Het
Slamf1	C	A	1: 171,604,652 (GRCm39)	Q141K	possibly damaging	Het
Speer4c1	A	C	5: 15,919,214 (GRCm39)		probably benign	Het
Tpo	T	C	12: 30,124,170 (GRCm39)	T877A	probably benign	Het
Ugt1a1	AT	A	1: 88,140,093 (GRCm39)		probably null	Het
Vmn1r37	A	G	6: 66,709,172 (GRCm39)	K229R	possibly damaging	Het
Wdr17	T	C	8: 55,102,178 (GRCm39)	D947G	probably damaging	Het
Wiz	G	T	17: 32,578,093 (GRCm39)	T473K	probably damaging	Het
Zmynd12	A	G	4: 119,280,186 (GRCm39)	Y35C	probably damaging	Het

Other mutations in Cilp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01291:Cilp	APN	9	65,186,265 (GRCm39)	missense	possibly damaging	0.80
IGL01340:Cilp	APN	9	65,183,256 (GRCm39)	missense	probably damaging	0.99
IGL02330:Cilp	APN	9	65,181,804 (GRCm39)	splice site	probably benign
IGL02729:Cilp	APN	9	65,185,372 (GRCm39)	missense	possibly damaging	0.63
IGL02833:Cilp	APN	9	65,185,206 (GRCm39)	missense	probably benign
IGL02961:Cilp	APN	9	65,185,891 (GRCm39)	missense	possibly damaging	0.88
IGL03137:Cilp	APN	9	65,185,450 (GRCm39)	missense	probably benign
IGL03211:Cilp	APN	9	65,187,457 (GRCm39)	missense	probably benign
IGL03301:Cilp	APN	9	65,187,499 (GRCm39)	missense	probably benign	0.01
IGL03341:Cilp	APN	9	65,185,284 (GRCm39)	missense	probably benign	0.07
ANU05:Cilp	UTSW	9	65,186,265 (GRCm39)	missense	possibly damaging	0.80
IGL02984:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
IGL02988:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
IGL02991:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
IGL03014:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
IGL03050:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
IGL03054:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
IGL03055:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
IGL03097:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
IGL03098:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
IGL03134:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
IGL03147:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
R0096:Cilp	UTSW	9	65,180,952 (GRCm39)	missense	possibly damaging	0.57
R0219:Cilp	UTSW	9	65,176,872 (GRCm39)	missense	possibly damaging	0.64
R0347:Cilp	UTSW	9	65,187,435 (GRCm39)	missense	probably benign
R0699:Cilp	UTSW	9	65,177,608 (GRCm39)	missense	probably damaging	1.00
R1148:Cilp	UTSW	9	65,187,598 (GRCm39)	missense	possibly damaging	0.96
R1148:Cilp	UTSW	9	65,187,598 (GRCm39)	missense	possibly damaging	0.96
R1155:Cilp	UTSW	9	65,176,869 (GRCm39)	missense	probably benign	0.01
R1544:Cilp	UTSW	9	65,183,127 (GRCm39)	missense	probably benign	0.03
R1584:Cilp	UTSW	9	65,186,997 (GRCm39)	missense	probably damaging	1.00
R1586:Cilp	UTSW	9	65,186,997 (GRCm39)	missense	probably damaging	1.00
R2055:Cilp	UTSW	9	65,186,997 (GRCm39)	missense	probably damaging	1.00
R2069:Cilp	UTSW	9	65,185,372 (GRCm39)	missense	possibly damaging	0.63
R2070:Cilp	UTSW	9	65,186,377 (GRCm39)	missense	probably damaging	1.00
R2414:Cilp	UTSW	9	65,181,927 (GRCm39)	splice site	probably benign
R4284:Cilp	UTSW	9	65,185,560 (GRCm39)	missense	probably damaging	1.00
R4630:Cilp	UTSW	9	65,187,162 (GRCm39)	missense	probably benign	0.17
R4632:Cilp	UTSW	9	65,187,162 (GRCm39)	missense	probably benign	0.17
R4870:Cilp	UTSW	9	65,186,980 (GRCm39)	missense	probably damaging	1.00
R4908:Cilp	UTSW	9	65,185,302 (GRCm39)	missense	probably benign	0.17
R5568:Cilp	UTSW	9	65,187,515 (GRCm39)	missense	probably benign	0.04
R5621:Cilp	UTSW	9	65,186,073 (GRCm39)	missense	possibly damaging	0.71
R5889:Cilp	UTSW	9	65,187,625 (GRCm39)	missense	possibly damaging	0.93
R6645:Cilp	UTSW	9	65,186,587 (GRCm39)	missense	possibly damaging	0.66
R6878:Cilp	UTSW	9	65,187,129 (GRCm39)	missense	probably damaging	1.00
R6982:Cilp	UTSW	9	65,187,087 (GRCm39)	missense	probably damaging	1.00
R7330:Cilp	UTSW	9	65,187,527 (GRCm39)	missense	probably benign
R7967:Cilp	UTSW	9	65,185,494 (GRCm39)	missense	possibly damaging	0.80
R8305:Cilp	UTSW	9	65,186,286 (GRCm39)	missense	probably damaging	0.98
R8306:Cilp	UTSW	9	65,186,286 (GRCm39)	missense	probably damaging	0.98
R8307:Cilp	UTSW	9	65,186,286 (GRCm39)	missense	probably damaging	0.98
R8308:Cilp	UTSW	9	65,186,286 (GRCm39)	missense	probably damaging	0.98
R8386:Cilp	UTSW	9	65,186,286 (GRCm39)	missense	probably damaging	0.98
R8407:Cilp	UTSW	9	65,181,898 (GRCm39)	missense	probably damaging	1.00
R8542:Cilp	UTSW	9	65,185,405 (GRCm39)	missense	probably damaging	1.00
R8794:Cilp	UTSW	9	65,186,535 (GRCm39)	missense	probably benign	0.26
R8951:Cilp	UTSW	9	65,180,220 (GRCm39)	missense	probably benign	0.01
R9060:Cilp	UTSW	9	65,186,302 (GRCm39)	missense	probably benign	0.01
R9257:Cilp	UTSW	9	65,174,451 (GRCm39)	missense	possibly damaging	0.72
R9265:Cilp	UTSW	9	65,187,333 (GRCm39)	missense	probably benign
R9358:Cilp	UTSW	9	65,183,269 (GRCm39)	missense	probably benign
R9401:Cilp	UTSW	9	65,185,381 (GRCm39)	missense	probably damaging	0.98
X0024:Cilp	UTSW	9	65,186,925 (GRCm39)	missense	probably damaging	1.00
X0025:Cilp	UTSW	9	65,186,980 (GRCm39)	missense	probably damaging	1.00
Z1088:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
Z1176:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
Z1177:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CTCCTCCAGAATCATGAAGAGC -3'
(R):5'- ATCAGCATCATGAGGCAGAGAC -3'

Sequencing Primer
(F):5'- CCTCCAGAATCATGAAGAGCAATGTG -3'
(R):5'- CATCATGAGGCAGAGACAGTAAG -3'

Posted On

2017-01-27