Incidental Mutation 'R5852:Ccdc154'
ID454734
Institutional Source Beutler Lab
Gene Symbol Ccdc154
Ensembl Gene ENSMUSG00000059562
Gene Namecoiled-coil domain containing 154
SynonymsLOC207209
MMRRC Submission 043227-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R5852 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25162461-25171913 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25163209 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 34 (V34A)
Ref Sequence ENSEMBL: ENSMUSP00000138659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040729] [ENSMUST00000073277] [ENSMUST00000160961] [ENSMUST00000182292] [ENSMUST00000182621] [ENSMUST00000183178]
Predicted Effect probably benign
Transcript: ENSMUST00000040729
SMART Domains Protein: ENSMUSP00000035964
Gene: ENSMUSG00000036636

DomainStartEndE-ValueType
low complexity region 60 74 N/A INTRINSIC
Pfam:Voltage_CLC 183 594 1.5e-96 PFAM
CBS 632 687 8.38e-4 SMART
CBS 742 790 1.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073277
AA Change: V34A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073002
Gene: ENSMUSG00000059562
AA Change: V34A

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 48 578 1.4e-263 PFAM
low complexity region 631 642 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159426
Predicted Effect probably benign
Transcript: ENSMUST00000160961
SMART Domains Protein: ENSMUSP00000124194
Gene: ENSMUSG00000036636

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 40 54 N/A INTRINSIC
Pfam:Voltage_CLC 163 574 1.5e-93 PFAM
CBS 612 667 8.38e-4 SMART
CBS 722 770 1.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182292
AA Change: V34A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138191
Gene: ENSMUSG00000059562
AA Change: V34A

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 47 571 1.3e-250 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182621
AA Change: V34A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138090
Gene: ENSMUSG00000059562
AA Change: V34A

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 47 573 2.9e-252 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183178
AA Change: V34A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138659
Gene: ENSMUSG00000059562
AA Change: V34A

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,927,404 I453F probably damaging Het
Anpep C T 7: 79,838,972 W402* probably null Het
Apcdd1 T C 18: 62,937,063 S134P probably damaging Het
Cbwd1 A G 19: 24,955,405 V88A possibly damaging Het
Cntn3 A T 6: 102,420,416 N65K probably damaging Het
Cntn6 G T 6: 104,835,745 V663F probably damaging Het
Crisp3 A T 17: 40,225,820 C201* probably null Het
Dnhd1 T A 7: 105,695,748 W2100R probably damaging Het
Dync2h1 A T 9: 7,011,290 S3634R probably benign Het
Fam189a1 T A 7: 64,775,831 H171L probably damaging Het
Gucy1a2 T C 9: 3,865,460 F645L probably damaging Het
Hs6st3 G T 14: 119,869,326 R382L probably damaging Het
Il27 T A 7: 126,592,614 T89S possibly damaging Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Klhl23 T A 2: 69,824,269 I161N probably benign Het
Lrrk2 G A 15: 91,755,949 E1566K probably damaging Het
Mia3 A G 1: 183,332,859 V437A probably benign Het
Ncoa6 G T 2: 155,405,499 H1962N possibly damaging Het
Nox4 C T 7: 87,338,964 T361I probably damaging Het
Pappa2 T C 1: 158,717,014 Y1748C probably damaging Het
Phyhip T C 14: 70,461,929 probably null Het
Pkhd1 A G 1: 20,377,408 F2254L probably benign Het
Plxnb1 A G 9: 109,106,450 Y1018C probably damaging Het
Pnoc C T 14: 65,411,222 V8I probably benign Het
Prss29 A G 17: 25,322,434 D256G probably benign Het
Scrn3 T C 2: 73,331,005 F312L probably damaging Het
Sephs1 A G 2: 4,899,528 E239G possibly damaging Het
Tti1 A G 2: 158,000,673 L812P probably damaging Het
Wdr1 A G 5: 38,537,175 S62P probably benign Het
Zfp106 A G 2: 120,516,006 S1659P probably damaging Het
Other mutations in Ccdc154
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02117:Ccdc154 APN 17 25167818 critical splice donor site probably null
IGL02427:Ccdc154 APN 17 25171757 critical splice acceptor site probably null
IGL03188:Ccdc154 APN 17 25164093 critical splice acceptor site probably null
R0256:Ccdc154 UTSW 17 25170632 missense probably benign 0.19
R0328:Ccdc154 UTSW 17 25171805 missense probably benign 0.25
R0583:Ccdc154 UTSW 17 25168424 missense possibly damaging 0.60
R0671:Ccdc154 UTSW 17 25167285 splice site probably benign
R0898:Ccdc154 UTSW 17 25164081 splice site probably benign
R1758:Ccdc154 UTSW 17 25163182 missense probably damaging 0.99
R2165:Ccdc154 UTSW 17 25170890 missense probably damaging 1.00
R2169:Ccdc154 UTSW 17 25170923 missense probably damaging 1.00
R4810:Ccdc154 UTSW 17 25163498 missense probably damaging 1.00
R4853:Ccdc154 UTSW 17 25170967 missense probably damaging 1.00
R4959:Ccdc154 UTSW 17 25170914 missense probably damaging 1.00
R4973:Ccdc154 UTSW 17 25170914 missense probably damaging 1.00
R5040:Ccdc154 UTSW 17 25164592 missense probably benign 0.04
R5153:Ccdc154 UTSW 17 25168341 missense probably damaging 1.00
R5179:Ccdc154 UTSW 17 25171163 missense probably benign 0.43
R5709:Ccdc154 UTSW 17 25170144 missense probably damaging 1.00
R5886:Ccdc154 UTSW 17 25171818 missense probably benign
R6191:Ccdc154 UTSW 17 25167971 missense probably damaging 1.00
R7101:Ccdc154 UTSW 17 25163468 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGATATGAGTCCCTGAGGTCAG -3'
(R):5'- TTGTGTCCCCTCAGACGAAC -3'

Sequencing Primer
(F):5'- GTCAGGGTGACAGCAAGC -3'
(R):5'- CCTGATTAGGGCCAGAGCAG -3'
Posted On2017-02-10