Incidental Mutation 'R5040:Ccdc154'
ID393193
Institutional Source Beutler Lab
Gene Symbol Ccdc154
Ensembl Gene ENSMUSG00000059562
Gene Namecoiled-coil domain containing 154
SynonymsLOC207209
MMRRC Submission 042630-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R5040 (G1)
Quality Score211
Status Validated
Chromosome17
Chromosomal Location25162461-25171913 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25164592 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 208 (T208S)
Ref Sequence ENSEMBL: ENSMUSP00000138090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040729] [ENSMUST00000073277] [ENSMUST00000160961] [ENSMUST00000182292] [ENSMUST00000182621] [ENSMUST00000183178]
Predicted Effect probably benign
Transcript: ENSMUST00000040729
SMART Domains Protein: ENSMUSP00000035964
Gene: ENSMUSG00000036636

DomainStartEndE-ValueType
low complexity region 60 74 N/A INTRINSIC
Pfam:Voltage_CLC 183 594 1.5e-96 PFAM
CBS 632 687 8.38e-4 SMART
CBS 742 790 1.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073277
AA Change: T208S

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000073002
Gene: ENSMUSG00000059562
AA Change: T208S

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 48 578 1.4e-263 PFAM
low complexity region 631 642 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159426
Predicted Effect probably benign
Transcript: ENSMUST00000160961
SMART Domains Protein: ENSMUSP00000124194
Gene: ENSMUSG00000036636

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 40 54 N/A INTRINSIC
Pfam:Voltage_CLC 163 574 1.5e-93 PFAM
CBS 612 667 8.38e-4 SMART
CBS 722 770 1.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182292
AA Change: T208S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000138191
Gene: ENSMUSG00000059562
AA Change: T208S

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 47 571 1.3e-250 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182621
AA Change: T208S

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000138090
Gene: ENSMUSG00000059562
AA Change: T208S

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 47 573 2.9e-252 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183178
SMART Domains Protein: ENSMUSP00000138659
Gene: ENSMUSG00000059562

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,475,001 D284V probably damaging Het
Abcc6 T C 7: 46,020,154 Q159R probably benign Het
AF067063 C T 13: 119,828,489 W57* probably null Het
Ap2a1 T C 7: 44,905,804 I446V possibly damaging Het
Areg A T 5: 91,144,339 H166L possibly damaging Het
Arhgap15 T C 2: 43,844,813 probably null Het
Arhgef17 T C 7: 100,876,825 D874G probably benign Het
Cast T C 13: 74,724,813 T452A probably damaging Het
Chst11 T A 10: 83,190,946 L69Q probably benign Het
Clec2d G A 6: 129,184,830 R142K probably damaging Het
Dis3l2 A T 1: 86,857,337 I303F probably damaging Het
Dusp27 G A 1: 166,100,345 T566I probably benign Het
Dync2h1 A G 9: 6,992,625 Y3979H probably benign Het
Ehmt1 A T 2: 24,884,304 C162S probably benign Het
Eif4g3 G T 4: 138,096,889 M239I probably damaging Het
Eif5 A G 12: 111,539,850 D41G probably damaging Het
Fat1 C T 8: 45,023,380 A1821V probably damaging Het
Fry G A 5: 150,388,854 A745T probably damaging Het
Galnt9 T C 5: 110,617,905 L491P probably damaging Het
Gata3 A G 2: 9,858,515 L396P probably damaging Het
Grasp G A 15: 101,229,042 V134I probably damaging Het
Gyg A G 3: 20,122,659 probably benign Het
Hhip C A 8: 79,997,606 V336L probably benign Het
Hipk2 G A 6: 38,730,881 P660S possibly damaging Het
Hnrnpul1 G A 7: 25,742,989 T276I possibly damaging Het
Ifnl2 G T 7: 28,509,086 R147S possibly damaging Het
Ilvbl A G 10: 78,583,318 D467G probably damaging Het
Kcnh1 A T 1: 192,505,475 H748L probably benign Het
Lyg1 A C 1: 37,950,811 probably benign Het
Mak A G 13: 41,030,098 Y544H possibly damaging Het
Med1 A G 11: 98,155,404 probably benign Het
Mogat2 T C 7: 99,238,517 T17A possibly damaging Het
Myom3 T C 4: 135,789,659 S847P probably damaging Het
Nprl2 T G 9: 107,542,400 C9G probably null Het
Olfr1456-ps1 T A 19: 13,078,943 noncoding transcript Het
Pcmtd1 T C 1: 7,120,375 Y23H probably damaging Het
Pkd1 C A 17: 24,571,260 H972Q probably benign Het
Rbm26 A G 14: 105,121,016 I929T probably benign Het
Scrn2 A G 11: 97,030,883 T60A probably damaging Het
Setdb2 A T 14: 59,415,707 I398N probably damaging Het
Setx A G 2: 29,139,338 E206G probably damaging Het
Sez6 T C 11: 77,969,089 probably null Het
Sh3bp4 C T 1: 89,144,240 S270L probably damaging Het
Stac3 T C 10: 127,508,124 I297T probably damaging Het
Supv3l1 A T 10: 62,447,065 V139E possibly damaging Het
Syce1 A T 7: 140,779,065 H178Q probably damaging Het
Tcp10c T A 17: 13,368,191 M344K possibly damaging Het
Tmc1 A G 19: 20,824,030 V502A possibly damaging Het
Tmco4 G T 4: 139,020,166 G242V probably damaging Het
Trp53bp2 G A 1: 182,444,706 R460H probably damaging Het
Virma T A 4: 11,528,746 C1328S probably benign Het
Zfp366 A G 13: 99,228,367 D12G probably damaging Het
Zfp457 C T 13: 67,292,835 A463T probably benign Het
Other mutations in Ccdc154
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02117:Ccdc154 APN 17 25167818 critical splice donor site probably null
IGL02427:Ccdc154 APN 17 25171757 critical splice acceptor site probably null
IGL03188:Ccdc154 APN 17 25164093 critical splice acceptor site probably null
R0256:Ccdc154 UTSW 17 25170632 missense probably benign 0.19
R0328:Ccdc154 UTSW 17 25171805 missense probably benign 0.25
R0583:Ccdc154 UTSW 17 25168424 missense possibly damaging 0.60
R0671:Ccdc154 UTSW 17 25167285 splice site probably benign
R0898:Ccdc154 UTSW 17 25164081 splice site probably benign
R1758:Ccdc154 UTSW 17 25163182 missense probably damaging 0.99
R2165:Ccdc154 UTSW 17 25170890 missense probably damaging 1.00
R2169:Ccdc154 UTSW 17 25170923 missense probably damaging 1.00
R4810:Ccdc154 UTSW 17 25163498 missense probably damaging 1.00
R4853:Ccdc154 UTSW 17 25170967 missense probably damaging 1.00
R4959:Ccdc154 UTSW 17 25170914 missense probably damaging 1.00
R4973:Ccdc154 UTSW 17 25170914 missense probably damaging 1.00
R5153:Ccdc154 UTSW 17 25168341 missense probably damaging 1.00
R5179:Ccdc154 UTSW 17 25171163 missense probably benign 0.43
R5709:Ccdc154 UTSW 17 25170144 missense probably damaging 1.00
R5852:Ccdc154 UTSW 17 25163209 missense probably benign
R5886:Ccdc154 UTSW 17 25171818 missense probably benign
R6191:Ccdc154 UTSW 17 25167971 missense probably damaging 1.00
R7101:Ccdc154 UTSW 17 25163468 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTTCCATGTGTCACCTGGG -3'
(R):5'- GGCAACCATATCAGACAGGG -3'

Sequencing Primer
(F):5'- CACCTGGGTGGATTGTGTACTCC -3'
(R):5'- GTGAGCCTATCCTTGTACCCTGAAG -3'
Posted On2016-06-15