Mutagenetix > Incidental Mutations

Incidental Mutation 'R5852:Cntn6'

454718

Institutional Source

Beutler Lab

Gene Symbol

Cntn6

Ensembl Gene

ENSMUSG00000030092

Gene Name

contactin 6

Synonyms

NB-3

MMRRC Submission

043227-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.163) question?

Stock #

R5852 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104492790-104863406 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 104835745 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 663 (V663F)

Ref Sequence

ENSEMBL: ENSMUSP00000124025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]

AlphaFold

Q9JMB8

Predicted Effect

probably damaging
Transcript: ENSMUST00000089215
AA Change: V663F

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: V663F

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161070
AA Change: V591F

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: V591F

Domain	Start	End	E-Value	Type
SCOP:d1cs6a4	4	40	5e-4	SMART
IG	57	145	2.28e-7	SMART
IGc2	168	232	4e-12	SMART
IGc2	258	321	4.52e-11	SMART
IGc2	350	414	5.48e-10	SMART
IGc2	440	512	1.44e-4	SMART
FN3	526	612	2.17e-11	SMART
FN3	629	715	8.62e0	SMART
FN3	731	816	9.92e-6	SMART
FN3	831	911	8.17e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000162872
AA Change: V663F

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: V663F

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	T	A	12: 118,927,404	I453F	probably damaging	Het
Anpep	C	T	7: 79,838,972	W402*	probably null	Het
Apcdd1	T	C	18: 62,937,063	S134P	probably damaging	Het
Cbwd1	A	G	19: 24,955,405	V88A	possibly damaging	Het
Ccdc154	T	C	17: 25,163,209	V34A	probably benign	Het
Cntn3	A	T	6: 102,420,416	N65K	probably damaging	Het
Crisp3	A	T	17: 40,225,820	C201*	probably null	Het
Dnhd1	T	A	7: 105,695,748	W2100R	probably damaging	Het
Dync2h1	A	T	9: 7,011,290	S3634R	probably benign	Het
Fam189a1	T	A	7: 64,775,831	H171L	probably damaging	Het
Gucy1a2	T	C	9: 3,865,460	F645L	probably damaging	Het
Hs6st3	G	T	14: 119,869,326	R382L	probably damaging	Het
Il27	T	A	7: 126,592,614	T89S	possibly damaging	Het
Iqgap2	C	T	13: 95,675,372	R707H	probably damaging	Het
Klhl23	T	A	2: 69,824,269	I161N	probably benign	Het
Lrrk2	G	A	15: 91,755,949	E1566K	probably damaging	Het
Mia3	A	G	1: 183,332,859	V437A	probably benign	Het
Ncoa6	G	T	2: 155,405,499	H1962N	possibly damaging	Het
Nox4	C	T	7: 87,338,964	T361I	probably damaging	Het
Pappa2	T	C	1: 158,717,014	Y1748C	probably damaging	Het
Phyhip	T	C	14: 70,461,929		probably null	Het
Pkhd1	A	G	1: 20,377,408	F2254L	probably benign	Het
Plxnb1	A	G	9: 109,106,450	Y1018C	probably damaging	Het
Pnoc	C	T	14: 65,411,222	V8I	probably benign	Het
Prss29	A	G	17: 25,322,434	D256G	probably benign	Het
Scrn3	T	C	2: 73,331,005	F312L	probably damaging	Het
Sephs1	A	G	2: 4,899,528	E239G	possibly damaging	Het
Tti1	A	G	2: 158,000,673	L812P	probably damaging	Het
Wdr1	A	G	5: 38,537,175	S62P	probably benign	Het
Zfp106	A	G	2: 120,516,006	S1659P	probably damaging	Het

Other mutations in Cntn6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Cntn6	APN	6	104650400	missense	probably damaging	0.99
IGL01331:Cntn6	APN	6	104774523	missense	probably damaging	1.00
IGL01619:Cntn6	APN	6	104728374	splice site	probably benign
IGL02028:Cntn6	APN	6	104859426	missense	probably damaging	0.99
IGL02420:Cntn6	APN	6	104846142	critical splice donor site	probably null
IGL02557:Cntn6	APN	6	104774535	missense	probably damaging	1.00
IGL03000:Cntn6	APN	6	104804386	missense	probably damaging	1.00
IGL03367:Cntn6	APN	6	104804338	missense	probably damaging	1.00
IGL03383:Cntn6	APN	6	104776457	splice site	probably benign
PIT4366001:Cntn6	UTSW	6	104832537	missense	probably benign	0.05
R0490:Cntn6	UTSW	6	104833918	missense	possibly damaging	0.91
R0583:Cntn6	UTSW	6	104776314	missense	possibly damaging	0.79
R0636:Cntn6	UTSW	6	104863148	missense	probably benign	0.00
R0654:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R0960:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R1241:Cntn6	UTSW	6	104832509	missense	probably damaging	1.00
R1385:Cntn6	UTSW	6	104861900	missense	probably benign	0.07
R1401:Cntn6	UTSW	6	104804398	missense	possibly damaging	0.65
R1478:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R1542:Cntn6	UTSW	6	104848100	missense	probably damaging	1.00
R1593:Cntn6	UTSW	6	104832580	missense	possibly damaging	0.58
R1840:Cntn6	UTSW	6	104774480	missense	probably damaging	1.00
R2066:Cntn6	UTSW	6	104861822	nonsense	probably null
R2097:Cntn6	UTSW	6	104861949	missense	probably damaging	0.99
R2289:Cntn6	UTSW	6	104569028	start gained	probably benign
R2429:Cntn6	UTSW	6	104650565	missense	possibly damaging	0.96
R2967:Cntn6	UTSW	6	104726237	missense	probably benign	0.04
R4009:Cntn6	UTSW	6	104833822	missense	probably damaging	0.98
R4476:Cntn6	UTSW	6	104772561	missense	probably damaging	1.00
R4664:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4666:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4701:Cntn6	UTSW	6	104804360	missense	probably benign	0.01
R4780:Cntn6	UTSW	6	104845784	missense	probably damaging	1.00
R4854:Cntn6	UTSW	6	104859475	missense	possibly damaging	0.95
R4965:Cntn6	UTSW	6	104774474	missense	probably damaging	0.99
R5051:Cntn6	UTSW	6	104772597	missense	probably damaging	1.00
R5075:Cntn6	UTSW	6	104833030	missense	probably damaging	1.00
R5152:Cntn6	UTSW	6	104569113	intron	probably benign
R5291:Cntn6	UTSW	6	104726135	missense	probably damaging	1.00
R5388:Cntn6	UTSW	6	104832562	missense	probably damaging	1.00
R5937:Cntn6	UTSW	6	104833103	missense	possibly damaging	0.68
R5980:Cntn6	UTSW	6	104848132	missense	probably damaging	0.98
R6290:Cntn6	UTSW	6	104767890	missense	probably damaging	1.00
R6338:Cntn6	UTSW	6	104726139	missense	probably damaging	1.00
R6396:Cntn6	UTSW	6	104650500	missense	probably damaging	1.00
R6447:Cntn6	UTSW	6	104859448	missense	probably damaging	1.00
R6860:Cntn6	UTSW	6	104861946	missense	possibly damaging	0.95
R6871:Cntn6	UTSW	6	104845758	frame shift	probably null
R7012:Cntn6	UTSW	6	104726262	missense	probably damaging	0.98
R7012:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R7337:Cntn6	UTSW	6	104650530	missense	probably damaging	0.99
R7658:Cntn6	UTSW	6	104650483	missense	probably benign	0.29
R8133:Cntn6	UTSW	6	104728337	missense	probably benign	0.19
R8463:Cntn6	UTSW	6	104772619	missense	possibly damaging	0.64
R8909:Cntn6	UTSW	6	104848132	missense	probably benign	0.05
R9232:Cntn6	UTSW	6	104838820	missense	probably damaging	1.00
R9287:Cntn6	UTSW	6	104832510	missense	possibly damaging	0.89
R9454:Cntn6	UTSW	6	104804347	missense	possibly damaging	0.82
X0020:Cntn6	UTSW	6	104767884	missense	probably benign	0.00
Z1177:Cntn6	UTSW	6	104832584	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACCAGACTGCCTAAAGC -3'
(R):5'- TAAAGGACCCACAGAAGCTTTTCTC -3'

Sequencing Primer
(F):5'- TGAGAGAAATCAACTTCAGACATTG -3'
(R):5'- CAGAAGCTTTTCTCTAAGAACCAG -3'

Posted On

2017-02-10