Incidental Mutation 'R5852:Cntn6'
ID 454718
Institutional Source Beutler Lab
Gene Symbol Cntn6
Ensembl Gene ENSMUSG00000030092
Gene Name contactin 6
Synonyms NB-3
MMRRC Submission 043227-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.133) question?
Stock # R5852 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 104492790-104863406 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 104835745 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 663 (V663F)
Ref Sequence ENSEMBL: ENSMUSP00000124025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]
AlphaFold Q9JMB8
Predicted Effect probably damaging
Transcript: ENSMUST00000089215
AA Change: V663F

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: V663F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161070
AA Change: V591F

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: V591F

DomainStartEndE-ValueType
SCOP:d1cs6a4 4 40 5e-4 SMART
IG 57 145 2.28e-7 SMART
IGc2 168 232 4e-12 SMART
IGc2 258 321 4.52e-11 SMART
IGc2 350 414 5.48e-10 SMART
IGc2 440 512 1.44e-4 SMART
FN3 526 612 2.17e-11 SMART
FN3 629 715 8.62e0 SMART
FN3 731 816 9.92e-6 SMART
FN3 831 911 8.17e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162872
AA Change: V663F

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: V663F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,927,404 I453F probably damaging Het
Anpep C T 7: 79,838,972 W402* probably null Het
Apcdd1 T C 18: 62,937,063 S134P probably damaging Het
Cbwd1 A G 19: 24,955,405 V88A possibly damaging Het
Ccdc154 T C 17: 25,163,209 V34A probably benign Het
Cntn3 A T 6: 102,420,416 N65K probably damaging Het
Crisp3 A T 17: 40,225,820 C201* probably null Het
Dnhd1 T A 7: 105,695,748 W2100R probably damaging Het
Dync2h1 A T 9: 7,011,290 S3634R probably benign Het
Fam189a1 T A 7: 64,775,831 H171L probably damaging Het
Gucy1a2 T C 9: 3,865,460 F645L probably damaging Het
Hs6st3 G T 14: 119,869,326 R382L probably damaging Het
Il27 T A 7: 126,592,614 T89S possibly damaging Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Klhl23 T A 2: 69,824,269 I161N probably benign Het
Lrrk2 G A 15: 91,755,949 E1566K probably damaging Het
Mia3 A G 1: 183,332,859 V437A probably benign Het
Ncoa6 G T 2: 155,405,499 H1962N possibly damaging Het
Nox4 C T 7: 87,338,964 T361I probably damaging Het
Pappa2 T C 1: 158,717,014 Y1748C probably damaging Het
Phyhip T C 14: 70,461,929 probably null Het
Pkhd1 A G 1: 20,377,408 F2254L probably benign Het
Plxnb1 A G 9: 109,106,450 Y1018C probably damaging Het
Pnoc C T 14: 65,411,222 V8I probably benign Het
Prss29 A G 17: 25,322,434 D256G probably benign Het
Scrn3 T C 2: 73,331,005 F312L probably damaging Het
Sephs1 A G 2: 4,899,528 E239G possibly damaging Het
Tti1 A G 2: 158,000,673 L812P probably damaging Het
Wdr1 A G 5: 38,537,175 S62P probably benign Het
Zfp106 A G 2: 120,516,006 S1659P probably damaging Het
Other mutations in Cntn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Cntn6 APN 6 104650400 missense probably damaging 0.99
IGL01331:Cntn6 APN 6 104774523 missense probably damaging 1.00
IGL01619:Cntn6 APN 6 104728374 splice site probably benign
IGL02028:Cntn6 APN 6 104859426 missense probably damaging 0.99
IGL02420:Cntn6 APN 6 104846142 critical splice donor site probably null
IGL02557:Cntn6 APN 6 104774535 missense probably damaging 1.00
IGL03000:Cntn6 APN 6 104804386 missense probably damaging 1.00
IGL03367:Cntn6 APN 6 104804338 missense probably damaging 1.00
IGL03383:Cntn6 APN 6 104776457 splice site probably benign
PIT4366001:Cntn6 UTSW 6 104832537 missense probably benign 0.05
R0490:Cntn6 UTSW 6 104833918 missense possibly damaging 0.91
R0583:Cntn6 UTSW 6 104776314 missense possibly damaging 0.79
R0636:Cntn6 UTSW 6 104863148 missense probably benign 0.00
R0654:Cntn6 UTSW 6 104776428 missense probably benign 0.00
R0960:Cntn6 UTSW 6 104774480 missense probably benign 0.01
R1241:Cntn6 UTSW 6 104832509 missense probably damaging 1.00
R1385:Cntn6 UTSW 6 104861900 missense probably benign 0.07
R1401:Cntn6 UTSW 6 104804398 missense possibly damaging 0.65
R1478:Cntn6 UTSW 6 104776428 missense probably benign 0.00
R1542:Cntn6 UTSW 6 104848100 missense probably damaging 1.00
R1593:Cntn6 UTSW 6 104832580 missense possibly damaging 0.58
R1840:Cntn6 UTSW 6 104774480 missense probably damaging 1.00
R2066:Cntn6 UTSW 6 104861822 nonsense probably null
R2097:Cntn6 UTSW 6 104861949 missense probably damaging 0.99
R2289:Cntn6 UTSW 6 104569028 start gained probably benign
R2429:Cntn6 UTSW 6 104650565 missense possibly damaging 0.96
R2967:Cntn6 UTSW 6 104726237 missense probably benign 0.04
R4009:Cntn6 UTSW 6 104833822 missense probably damaging 0.98
R4476:Cntn6 UTSW 6 104772561 missense probably damaging 1.00
R4664:Cntn6 UTSW 6 104728284 missense probably benign 0.20
R4666:Cntn6 UTSW 6 104728284 missense probably benign 0.20
R4701:Cntn6 UTSW 6 104804360 missense probably benign 0.01
R4780:Cntn6 UTSW 6 104845784 missense probably damaging 1.00
R4854:Cntn6 UTSW 6 104859475 missense possibly damaging 0.95
R4965:Cntn6 UTSW 6 104774474 missense probably damaging 0.99
R5051:Cntn6 UTSW 6 104772597 missense probably damaging 1.00
R5075:Cntn6 UTSW 6 104833030 missense probably damaging 1.00
R5152:Cntn6 UTSW 6 104569113 intron probably benign
R5291:Cntn6 UTSW 6 104726135 missense probably damaging 1.00
R5388:Cntn6 UTSW 6 104832562 missense probably damaging 1.00
R5937:Cntn6 UTSW 6 104833103 missense possibly damaging 0.68
R5980:Cntn6 UTSW 6 104848132 missense probably damaging 0.98
R6290:Cntn6 UTSW 6 104767890 missense probably damaging 1.00
R6338:Cntn6 UTSW 6 104726139 missense probably damaging 1.00
R6396:Cntn6 UTSW 6 104650500 missense probably damaging 1.00
R6447:Cntn6 UTSW 6 104859448 missense probably damaging 1.00
R6860:Cntn6 UTSW 6 104861946 missense possibly damaging 0.95
R6871:Cntn6 UTSW 6 104845758 frame shift probably null
R7012:Cntn6 UTSW 6 104726262 missense probably damaging 0.98
R7012:Cntn6 UTSW 6 104774480 missense probably benign 0.01
R7337:Cntn6 UTSW 6 104650530 missense probably damaging 0.99
R7658:Cntn6 UTSW 6 104650483 missense probably benign 0.29
R8133:Cntn6 UTSW 6 104728337 missense probably benign 0.19
R8463:Cntn6 UTSW 6 104772619 missense possibly damaging 0.64
R8909:Cntn6 UTSW 6 104848132 missense probably benign 0.05
R9232:Cntn6 UTSW 6 104838820 missense probably damaging 1.00
R9287:Cntn6 UTSW 6 104832510 missense possibly damaging 0.89
R9454:Cntn6 UTSW 6 104804347 missense possibly damaging 0.82
R9698:Cntn6 UTSW 6 104833083 nonsense probably null
X0020:Cntn6 UTSW 6 104767884 missense probably benign 0.00
Z1177:Cntn6 UTSW 6 104832584 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCAGACTGCCTAAAGC -3'
(R):5'- TAAAGGACCCACAGAAGCTTTTCTC -3'

Sequencing Primer
(F):5'- TGAGAGAAATCAACTTCAGACATTG -3'
(R):5'- CAGAAGCTTTTCTCTAAGAACCAG -3'
Posted On 2017-02-10