Incidental Mutation 'R5965:Nmbr'
ID472035
Institutional Source Beutler Lab
Gene Symbol Nmbr
Ensembl Gene ENSMUSG00000019865
Gene Nameneuromedin B receptor
Synonyms
MMRRC Submission 044150-MU
Accession Numbers

Genbank: NM_008703

Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R5965 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location14705591-14770850 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 14766810 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 38 (R38S)
Ref Sequence ENSEMBL: ENSMUSP00000140754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020015] [ENSMUST00000186382] [ENSMUST00000190114] [ENSMUST00000190751] [ENSMUST00000191238]
Predicted Effect probably benign
Transcript: ENSMUST00000020015
AA Change: R186S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020015
Gene: ENSMUSG00000019865
AA Change: R186S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 54 339 5.9e-9 PFAM
Pfam:7tm_1 60 325 2.9e-55 PFAM
Pfam:7TM_GPCR_Srv 92 341 2.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186382
AA Change: R186S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139612
Gene: ENSMUSG00000019865
AA Change: R186S

DomainStartEndE-ValueType
Pfam:7tm_1 60 257 1.4e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190114
AA Change: R38S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000140754
Gene: ENSMUSG00000019865
AA Change: R38S

DomainStartEndE-ValueType
Pfam:7tm_1 8 119 6.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190751
SMART Domains Protein: ENSMUSP00000140223
Gene: ENSMUSG00000019865

DomainStartEndE-ValueType
Pfam:7tm_1 60 144 2.7e-21 PFAM
transmembrane domain 152 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191238
Meta Mutation Damage Score 0.1046 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.1%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 7-transmembrane G protein-coupled receptor that binds neuromedin B, which is a growth factor and mitogen for gastrointestinal epithelial tissue and for normal and neoplastic lung. This receptor may play a role in smooth muscle contraction, neuronal responses, and the regulation of cell growth. Antagonists of this receptor have a potential therapeutic use in inhibiting tumor cell growth. Polymorphisms in this gene may be associated with a susceptibility for schizophrenia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele show a 50% reduction in the thermoregulatory response to neuromedin B as well as impaired maternal behavior in response to restraint-induced stress. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T A 5: 30,205,639 T23S probably benign Het
Armc2 A G 10: 41,922,572 I747T possibly damaging Het
Cacna1c T A 6: 118,602,300 H1729L probably damaging Het
Crebbp A G 16: 4,087,661 probably benign Het
Cyp4f17 T A 17: 32,524,637 M326K probably damaging Het
D230025D16Rik T C 8: 105,234,539 F69L probably damaging Het
Dchs1 T G 7: 105,755,925 D2470A probably damaging Het
Ddhd2 T C 8: 25,735,777 T518A probably damaging Het
Derl2 T C 11: 71,014,552 T109A probably benign Het
Dnah7b T C 1: 46,362,987 L3994P probably damaging Het
Dock10 T C 1: 80,568,744 probably null Het
Dync1h1 T A 12: 110,632,778 S1856T probably benign Het
Ehd2 T C 7: 15,952,074 K358E possibly damaging Het
Enpp2 A G 15: 54,882,971 probably null Het
Esco1 T C 18: 10,593,867 E473G possibly damaging Het
Exoc5 A G 14: 49,034,931 F342S probably damaging Het
Fam186a T A 15: 99,945,097 T1089S probably benign Het
Fam71d T A 12: 78,710,306 N12K unknown Het
Fanca T C 8: 123,316,410 D79G possibly damaging Het
Gabrb2 A G 11: 42,626,869 Y506C probably damaging Het
Galntl6 T C 8: 57,857,531 T379A probably benign Het
Gm34768 A G 2: 11,908,505 noncoding transcript Het
Gps2 A G 11: 69,914,794 E46G possibly damaging Het
Gsdmc T C 15: 63,804,598 probably null Het
Gys1 C T 7: 45,455,339 T666I probably benign Het
Hsd17b11 T A 5: 104,021,785 probably benign Het
Iffo1 T A 6: 125,152,508 probably benign Het
Ighv1-51 T C 12: 115,131,557 noncoding transcript Het
Kansl3 T A 1: 36,345,520 probably null Het
Kdm3a A G 6: 71,621,380 I174T probably benign Het
Klhl26 A T 8: 70,452,731 D95E probably damaging Het
Lair1 T C 7: 4,029,024 D28G possibly damaging Het
Lama3 A G 18: 12,429,887 D489G possibly damaging Het
Lamb3 A T 1: 193,343,460 I1153F probably damaging Het
Lsp1 T A 7: 142,490,424 probably null Het
Man1a A G 10: 53,933,490 probably benign Het
Mcam A C 9: 44,136,628 S57R probably damaging Het
Mrgprf C A 7: 145,307,431 probably benign Het
Nfia T C 4: 98,111,292 *499Q probably null Het
Olfr1126 T G 2: 87,458,037 F291V probably benign Het
Olfr191 T C 16: 59,086,303 Y60C probably damaging Het
Olfr559 C A 7: 102,724,260 V77L probably benign Het
P3h1 C T 4: 119,248,227 H741Y probably benign Het
Parp4 A T 14: 56,624,032 M941L probably benign Het
Pik3c3 C T 18: 30,298,580 T331M probably damaging Het
Prkg1 T C 19: 30,724,156 probably null Het
Qsox2 A T 2: 26,222,221 V103D probably benign Het
Ranbp1 T C 16: 18,245,228 T95A probably damaging Het
Ric1 G A 19: 29,570,771 D280N probably damaging Het
Scd1 A G 19: 44,400,140 probably null Het
Serpinb3c A G 1: 107,276,923 I31T probably benign Het
Slc7a11 T A 3: 50,379,144 Y386F probably benign Het
Smtnl2 A T 11: 72,400,453 probably null Het
Snx2 G T 18: 53,194,462 E87* probably null Het
Tars2 A C 3: 95,748,152 probably null Het
Tax1bp1 C A 6: 52,729,332 T106N probably damaging Het
Tcof1 A G 18: 60,833,418 probably null Het
Tenm3 C A 8: 48,228,508 E2680* probably null Het
Thap7 C T 16: 17,530,747 probably benign Het
Thoc6 T A 17: 23,670,868 I23F possibly damaging Het
Tmem185b T G 1: 119,526,564 Y18* probably null Het
Trav6-1 A C 14: 52,638,797 Y58S probably damaging Het
Trbv16 A T 6: 41,152,055 I58F probably benign Het
Ubtfl1 T A 9: 18,409,542 M122K probably benign Het
Vps13a T C 19: 16,619,028 probably null Het
Zdhhc24 T G 19: 4,883,750 D278E probably benign Het
Zfp316 T C 5: 143,264,672 probably null Het
Zfyve9 T C 4: 108,691,681 T769A possibly damaging Het
Znhit6 T A 3: 145,578,348 N96K possibly damaging Het
Other mutations in Nmbr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01617:Nmbr APN 10 14770429 missense probably benign 0.19
IGL01874:Nmbr APN 10 14766952 missense probably benign 0.09
IGL02616:Nmbr APN 10 14760687 intron probably benign
IGL02619:Nmbr APN 10 14760587 missense probably damaging 0.99
IGL03015:Nmbr APN 10 14760668 missense probably damaging 1.00
G5030:Nmbr UTSW 10 14767003 missense possibly damaging 0.95
R0057:Nmbr UTSW 10 14760524 missense probably damaging 0.97
R0238:Nmbr UTSW 10 14770395 nonsense probably null
R0238:Nmbr UTSW 10 14770395 nonsense probably null
R0324:Nmbr UTSW 10 14760448 missense possibly damaging 0.50
R1252:Nmbr UTSW 10 14760443 missense probably benign 0.09
R1812:Nmbr UTSW 10 14760539 splice site probably null
R1831:Nmbr UTSW 10 14766865 missense probably benign 0.36
R2140:Nmbr UTSW 10 14770442 nonsense probably null
R2141:Nmbr UTSW 10 14770442 nonsense probably null
R4604:Nmbr UTSW 10 14770164 missense probably damaging 1.00
R4936:Nmbr UTSW 10 14766986 missense probably damaging 1.00
R6636:Nmbr UTSW 10 14770234 missense probably benign 0.23
R6895:Nmbr UTSW 10 14769960 makesense probably null
R7644:Nmbr UTSW 10 14760689 missense probably damaging 1.00
Z1177:Nmbr UTSW 10 14770327 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCACCTCTATTGCCAGTGAG -3'
(R):5'- GTATTCTCCAGGAAGATTGTGTGC -3'

Sequencing Primer
(F):5'- ATTGCCAGTGAGATTTATTTTCCTC -3'
(R):5'- GCTGATGATAACAAGGGGTA -3'
Posted On2017-03-31