Incidental Mutation 'R6013:H2-T23'
ID479879
Institutional Source Beutler Lab
Gene Symbol H2-T23
Ensembl Gene ENSMUSG00000067212
Gene Namehistocompatibility 2, T region locus 23
Synonyms37b, T18c(37), 37c, Qa-1, Qed-1, T23b, T18c, T23d, H-2T23, Qa1
MMRRC Submission 044189-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6013 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location36029773-36032855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 36030582 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 332 (H332Q)
Ref Sequence ENSEMBL: ENSMUSP00000099739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102678]
PDB Structure
Structure of the MHC class Ib molecule Qa-1b [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000102678
AA Change: H332Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099739
Gene: ENSMUSG00000067212
AA Change: H332Q

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 21 199 1.9e-93 PFAM
IGc1 218 289 1.89e-22 SMART
transmembrane domain 304 326 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174839
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: CD4+ T cells from mice with a homozygous null mutation have enhanced responses after infection or immunization, are resistant to suppressor activity mediated by a subset of CD8+ T cells, but are more susceptible to NK cell lysis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik C T 3: 6,617,250 probably null Het
Aanat A T 11: 116,596,124 probably null Het
Abca17 A T 17: 24,287,846 V1178E possibly damaging Het
Abcf3 T A 16: 20,550,561 probably null Het
Alk A G 17: 71,900,737 M1001T probably benign Het
Arhgap23 C A 11: 97,500,992 S1445Y probably damaging Het
Atp10a T C 7: 58,797,790 I760T probably benign Het
BC030867 T C 11: 102,255,033 V45A probably benign Het
Cadm1 C T 9: 47,857,274 probably benign Het
Car10 A T 11: 93,185,279 probably benign Het
Casq2 G T 3: 102,145,629 probably null Het
Clec4f T C 6: 83,655,088 I55V probably benign Het
Cngb1 T C 8: 95,284,321 probably benign Het
Csn1s2b A G 5: 87,824,239 probably null Het
Cyp2c39 A C 19: 39,513,525 R119S probably benign Het
Cyp4f16 C T 17: 32,546,678 A345V probably null Het
Ddx43 T C 9: 78,414,285 L412S probably damaging Het
Dnajb12 G A 10: 59,894,341 probably null Het
Ephx2 A G 14: 66,110,242 S56P probably benign Het
Fam83h A G 15: 76,004,000 F496S probably damaging Het
Gcnt4 T C 13: 96,947,278 S361P possibly damaging Het
Ift57 G T 16: 49,699,304 probably null Het
Il1rl2 A G 1: 40,351,857 H320R possibly damaging Het
Kansl1 A G 11: 104,350,639 V618A probably benign Het
Kctd3 T C 1: 188,996,468 E157G probably benign Het
Magohb T A 6: 131,293,074 D31V possibly damaging Het
Mdn1 C A 4: 32,715,713 F1993L probably damaging Het
Med29 C A 7: 28,386,993 C130F probably benign Het
Mtmr7 G A 8: 40,581,528 R251C probably damaging Het
Ncor1 T C 11: 62,321,077 I49V probably benign Het
Nfkb1 G T 3: 135,626,684 T109K possibly damaging Het
Pkd1l1 A G 11: 8,869,452 probably null Het
Pkp1 T A 1: 135,883,910 T408S probably damaging Het
Plec A T 15: 76,189,310 D501E possibly damaging Het
Ppil2 T C 16: 17,100,265 N96D probably damaging Het
Prcp A C 7: 92,927,768 Y335S possibly damaging Het
Reg2 T A 6: 78,407,969 Y165N possibly damaging Het
Rnf7 T C 9: 96,471,734 *114W probably null Het
Scg3 T C 9: 75,676,808 D137G probably damaging Het
Serpinb7 T C 1: 107,450,189 V204A probably benign Het
Sez6 C T 11: 77,973,797 H528Y probably damaging Het
Sf3b1 A T 1: 55,000,298 S723T probably damaging Het
Shtn1 T C 19: 58,975,101 D594G probably damaging Het
Sptbn4 A G 7: 27,364,479 L2174P probably damaging Het
Stk25 A G 1: 93,625,459 probably null Het
Tep1 A T 14: 50,861,048 F429I probably damaging Het
Thada T A 17: 84,272,800 I1409F probably benign Het
Tmem2 G A 19: 21,832,039 V928I possibly damaging Het
Usp25 G A 16: 77,077,021 G495E probably benign Het
Washc2 A G 6: 116,254,153 S844G probably damaging Het
Xirp2 A T 2: 67,510,943 H1176L possibly damaging Het
Zfand6 C A 7: 84,632,692 V110L probably benign Het
Zfp30 A G 7: 29,789,421 R8G possibly damaging Het
Other mutations in H2-T23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:H2-T23 APN 17 36031781 missense probably damaging 1.00
IGL01685:H2-T23 APN 17 36032644 missense probably benign 0.29
IGL02756:H2-T23 APN 17 36031688 missense probably damaging 1.00
IGL03036:H2-T23 APN 17 36032357 missense possibly damaging 0.73
LCD18:H2-T23 UTSW 17 36031216 intron probably benign
R0539:H2-T23 UTSW 17 36032141 splice site probably benign
R0845:H2-T23 UTSW 17 36030583 missense probably benign 0.00
R1727:H2-T23 UTSW 17 36031653 missense possibly damaging 0.52
R2044:H2-T23 UTSW 17 36032191 missense probably damaging 1.00
R3121:H2-T23 UTSW 17 36030963 missense probably benign 0.13
R3122:H2-T23 UTSW 17 36030963 missense probably benign 0.13
R3943:H2-T23 UTSW 17 36030643 missense probably benign 0.01
R3944:H2-T23 UTSW 17 36030643 missense probably benign 0.01
R4492:H2-T23 UTSW 17 36032166 missense probably damaging 0.97
R4660:H2-T23 UTSW 17 36030216 missense probably damaging 0.99
R4669:H2-T23 UTSW 17 36031798 missense probably damaging 1.00
R4740:H2-T23 UTSW 17 36032124 intron probably benign
R5151:H2-T23 UTSW 17 36032338 missense probably damaging 1.00
R5196:H2-T23 UTSW 17 36032607 critical splice donor site probably null
R5237:H2-T23 UTSW 17 36030366 splice site probably null
R5307:H2-T23 UTSW 17 36032216 missense probably benign 0.00
R5336:H2-T23 UTSW 17 36031658 missense possibly damaging 0.85
R5646:H2-T23 UTSW 17 36031803 missense possibly damaging 0.49
R5800:H2-T23 UTSW 17 36031604 intron probably benign
R6081:H2-T23 UTSW 17 36031815 missense possibly damaging 0.90
R6382:H2-T23 UTSW 17 36031832 missense probably damaging 1.00
R7043:H2-T23 UTSW 17 36031911 missense probably damaging 1.00
R7134:H2-T23 UTSW 17 36031817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCGCACTTACCTAGAACATGAGC -3'
(R):5'- AGTTGGTCATGGCTCAGAGC -3'

Sequencing Primer
(F):5'- GCATCCTTTTACACCTGTGAGAAG -3'
(R):5'- GCTCAGAGCTGGGATCATAACC -3'
Posted On2017-06-26