Incidental Mutation 'R5993:Topaz1'
ID480953
Institutional Source Beutler Lab
Gene Symbol Topaz1
Ensembl Gene ENSMUSG00000094985
Gene Nametestis and ovary specific PAZ domain containing 1
SynonymsGm9524
MMRRC Submission 044172-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R5993 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location122747346-122802135 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122749039 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 338 (L338S)
Ref Sequence ENSEMBL: ENSMUSP00000136304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178679]
Predicted Effect probably benign
Transcript: ENSMUST00000178679
AA Change: L338S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136304
Gene: ENSMUSG00000094985
AA Change: L338S

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 27 39 N/A INTRINSIC
low complexity region 236 251 N/A INTRINSIC
low complexity region 531 545 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
low complexity region 1129 1139 N/A INTRINSIC
Pfam:Asp_Glu_race_2 1189 1422 3.6e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213519
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with abnormal meiosis and apoptosis of male germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 G T 15: 94,338,723 N805K probably damaging Het
Add1 A C 5: 34,601,533 S64R probably damaging Het
Akap2 A G 4: 57,855,273 K444E possibly damaging Het
Alas1 A G 9: 106,234,129 F613L probably benign Het
Ankrd17 A T 5: 90,339,672 probably benign Het
Anks3 C T 16: 4,958,137 G67D probably damaging Het
Aspm C T 1: 139,479,531 T2052I probably benign Het
Atp8b4 C T 2: 126,403,234 V332I probably benign Het
Bin2 CGGAGCTGA C 15: 100,645,020 probably null Het
Bpifb3 T A 2: 153,929,314 M382K probably benign Het
Ccdc149 C T 5: 52,402,775 R246Q probably damaging Het
Ccdc57 T C 11: 120,894,724 K462E possibly damaging Het
Cux1 T C 5: 136,363,271 T9A probably benign Het
Cyp2c23 A G 19: 44,012,360 Y362H probably damaging Het
D430041D05Rik A G 2: 104,168,067 I998T probably damaging Het
Dclre1a A C 19: 56,542,737 Y726D probably damaging Het
Dnah5 T C 15: 28,299,226 V1578A probably benign Het
Dppa4 C T 16: 48,289,346 R110* probably null Het
Drc7 T A 8: 95,074,192 V614E probably benign Het
Fam71d C A 12: 78,715,436 N12K probably damaging Het
Gcc1 G A 6: 28,424,852 probably null Het
Greb1l G A 18: 10,544,455 D1350N probably benign Het
Kcnc1 G A 7: 46,427,532 V253M probably damaging Het
Krt78 T A 15: 101,950,449 I323F probably damaging Het
Man2b2 A G 5: 36,820,980 V320A probably benign Het
Mphosph9 A T 5: 124,316,098 F112Y probably benign Het
Mrc1 A G 2: 14,305,327 T800A probably damaging Het
Mroh1 C A 15: 76,446,680 A1197E probably damaging Het
Nlrp10 A T 7: 108,927,013 H39Q probably benign Het
Nop2 C T 6: 125,144,019 T588I probably benign Het
Oxld1 A G 11: 120,457,009 S121P probably benign Het
Prox1 T A 1: 190,162,239 D3V probably damaging Het
Ptk7 T C 17: 46,565,370 T1052A probably benign Het
Rhot2 T A 17: 25,841,111 T299S probably benign Het
Rhov A G 2: 119,270,052 F235L probably damaging Het
Runx1t1 A T 4: 13,841,863 R158S probably damaging Het
Runx1t1 A T 4: 13,875,490 E431D probably benign Het
Sema3e A G 5: 14,224,293 E186G probably damaging Het
Sema5b T A 16: 35,646,202 L158H probably damaging Het
Serpina3j A G 12: 104,314,687 T40A probably benign Het
Shroom3 A T 5: 92,940,188 S185C probably damaging Het
Skint6 A T 4: 112,809,079 V1183D probably benign Het
Smg1 A G 7: 118,140,509 V3405A probably benign Het
Supt16 C A 14: 52,178,334 R357L probably damaging Het
Thrap3 A T 4: 126,175,460 probably null Het
Ttll3 T A 6: 113,398,031 Y139* probably null Het
Ttn T G 2: 76,795,907 D6641A probably damaging Het
Wwc1 T C 11: 35,852,336 D886G probably benign Het
Zc3h7a T A 16: 11,150,662 K484N probably damaging Het
Other mutations in Topaz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0083:Topaz1 UTSW 9 122775609 missense probably benign 0.08
R0098:Topaz1 UTSW 9 122790123 missense possibly damaging 0.93
R0098:Topaz1 UTSW 9 122790123 missense possibly damaging 0.93
R0108:Topaz1 UTSW 9 122775609 missense probably benign 0.08
R0220:Topaz1 UTSW 9 122749303 missense possibly damaging 0.53
R0519:Topaz1 UTSW 9 122749479 missense possibly damaging 0.53
R0617:Topaz1 UTSW 9 122749906 missense possibly damaging 0.73
R0637:Topaz1 UTSW 9 122791477 nonsense probably null
R0637:Topaz1 UTSW 9 122797662 missense probably benign
R1368:Topaz1 UTSW 9 122748250 missense possibly damaging 0.72
R1519:Topaz1 UTSW 9 122767011 missense probably benign 0.33
R1526:Topaz1 UTSW 9 122796043 missense probably damaging 0.98
R1634:Topaz1 UTSW 9 122780675 splice site probably benign
R1871:Topaz1 UTSW 9 122799479 missense probably benign 0.18
R1879:Topaz1 UTSW 9 122749619 missense possibly damaging 0.70
R1913:Topaz1 UTSW 9 122767013 missense possibly damaging 0.73
R1977:Topaz1 UTSW 9 122747362 missense unknown
R1989:Topaz1 UTSW 9 122750125 missense possibly damaging 0.86
R2237:Topaz1 UTSW 9 122771147 missense probably benign
R2238:Topaz1 UTSW 9 122771147 missense probably benign
R2239:Topaz1 UTSW 9 122771147 missense probably benign
R3160:Topaz1 UTSW 9 122749381 missense probably benign 0.33
R3161:Topaz1 UTSW 9 122749381 missense probably benign 0.33
R3162:Topaz1 UTSW 9 122749381 missense probably benign 0.33
R3821:Topaz1 UTSW 9 122797783 missense possibly damaging 0.85
R3822:Topaz1 UTSW 9 122797783 missense possibly damaging 0.85
R3944:Topaz1 UTSW 9 122750604 missense possibly damaging 0.73
R4571:Topaz1 UTSW 9 122747436 missense probably benign 0.01
R4580:Topaz1 UTSW 9 122747515 missense probably null 0.00
R5043:Topaz1 UTSW 9 122748404 missense probably benign
R5084:Topaz1 UTSW 9 122748818 missense probably benign 0.04
R5234:Topaz1 UTSW 9 122790193 missense possibly damaging 0.82
R5388:Topaz1 UTSW 9 122774093 missense possibly damaging 0.96
R5471:Topaz1 UTSW 9 122791416 intron probably null
R5706:Topaz1 UTSW 9 122799485 missense possibly damaging 0.53
R6104:Topaz1 UTSW 9 122749866 missense probably benign
R6137:Topaz1 UTSW 9 122797756 missense possibly damaging 0.53
R6186:Topaz1 UTSW 9 122748826 missense probably benign 0.33
R6209:Topaz1 UTSW 9 122750505 missense possibly damaging 0.85
R6543:Topaz1 UTSW 9 122748535 missense possibly damaging 0.53
R6548:Topaz1 UTSW 9 122748354 missense possibly damaging 0.53
R6557:Topaz1 UTSW 9 122748895 missense probably benign 0.02
R6636:Topaz1 UTSW 9 122749786 missense probably benign 0.33
R6637:Topaz1 UTSW 9 122749786 missense probably benign 0.33
R6859:Topaz1 UTSW 9 122801958 missense probably benign 0.33
R7123:Topaz1 UTSW 9 122748415 missense probably damaging 1.00
R7180:Topaz1 UTSW 9 122797705 missense possibly damaging 0.85
R7319:Topaz1 UTSW 9 122750363 missense possibly damaging 0.73
R7743:Topaz1 UTSW 9 122785136 missense probably benign 0.16
R7810:Topaz1 UTSW 9 122749185 missense probably benign 0.18
R7871:Topaz1 UTSW 9 122780700 missense possibly damaging 0.96
R7875:Topaz1 UTSW 9 122749587 missense possibly damaging 0.53
R7954:Topaz1 UTSW 9 122780700 missense possibly damaging 0.96
R7958:Topaz1 UTSW 9 122749587 missense possibly damaging 0.53
X0020:Topaz1 UTSW 9 122774069 missense possibly damaging 0.96
Z1176:Topaz1 UTSW 9 122791494 missense not run
Predicted Primers PCR Primer
(F):5'- GCTTGACTTCTTGCCTTCAAAG -3'
(R):5'- ATACGTTTGCATCCTAAGGACTC -3'

Sequencing Primer
(F):5'- ATTCAGTAGAGGAGAACAAC -3'
(R):5'- CGTTTGCATCCTAAGGACTCTGAAG -3'
Posted On2017-06-26