Incidental Mutation 'R6112:Tenm1'
ID484931
Institutional Source Beutler Lab
Gene Symbol Tenm1
Ensembl Gene ENSMUSG00000016150
Gene Nameteneurin transmembrane protein 1
SynonymsTCAP-1, teneurin-1, Odz1, Ten-m1
MMRRC Submission 044261-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R6112 (G1)
Quality Score221.999
Status Validated
ChromosomeX
Chromosomal Location42527866-43429126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 42827195 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 404 (G404E)
Ref Sequence ENSEMBL: ENSMUSP00000110711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016294] [ENSMUST00000115058] [ENSMUST00000115059]
Predicted Effect probably damaging
Transcript: ENSMUST00000016294
AA Change: G404E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016294
Gene: ENSMUSG00000016150
AA Change: G404E

DomainStartEndE-ValueType
Pfam:Ten_N 12 177 5.1e-30 PFAM
Pfam:Ten_N 168 317 1.5e-45 PFAM
transmembrane domain 318 340 N/A INTRINSIC
EGF 530 558 8.8e-3 SMART
EGF_like 561 589 2.5e-1 SMART
EGF 594 623 1.2e-2 SMART
EGF 626 655 4.5e-3 SMART
EGF 660 690 1.1e-1 SMART
EGF 693 721 6e-2 SMART
EGF 724 752 1.5e-2 SMART
EGF 763 795 1.6e-2 SMART
low complexity region 801 816 N/A INTRINSIC
Pfam:Tox-GHH 2647 2724 5e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115058
AA Change: G404E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110710
Gene: ENSMUSG00000016150
AA Change: G404E

DomainStartEndE-ValueType
Pfam:Ten_N 11 170 5.4e-36 PFAM
Pfam:Ten_N 159 317 7.4e-46 PFAM
transmembrane domain 318 340 N/A INTRINSIC
EGF 530 558 1.73e0 SMART
EGF_like 561 589 5.13e1 SMART
EGF 594 623 2.45e0 SMART
EGF 626 655 9.27e-1 SMART
EGF 660 690 2.29e1 SMART
EGF 693 721 1.2e1 SMART
EGF 724 752 3.01e0 SMART
EGF 763 795 3.23e0 SMART
low complexity region 801 816 N/A INTRINSIC
Pfam:Tox-GHH 2639 2717 1.1e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115059
AA Change: G404E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110711
Gene: ENSMUSG00000016150
AA Change: G404E

DomainStartEndE-ValueType
Pfam:Ten_N 11 170 1.2e-32 PFAM
Pfam:Ten_N 159 317 1.6e-42 PFAM
transmembrane domain 318 340 N/A INTRINSIC
EGF 530 558 8.6e-3 SMART
EGF_like 561 589 2.5e-1 SMART
EGF 594 623 1.2e-2 SMART
EGF 626 655 4.4e-3 SMART
EGF 660 690 1.1e-1 SMART
EGF 693 721 5.8e-2 SMART
EGF 724 752 1.5e-2 SMART
EGF 763 795 1.6e-2 SMART
low complexity region 801 816 N/A INTRINSIC
Pfam:Tox-GHH 2646 2724 2.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154433
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tenascin family and teneurin subfamily. It is expressed in the neurons and may function as a cellular signal transducer. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,460,916 Y1030C probably damaging Het
Adh5 G T 3: 138,451,268 V197F probably damaging Het
Ankmy1 A T 1: 92,870,962 F936I probably damaging Het
Aoc1 A T 6: 48,908,691 D710V probably damaging Het
Aplp1 T C 7: 30,435,477 E622G probably damaging Het
Arhgap20 T C 9: 51,829,384 Y219H probably damaging Het
Bag3 A G 7: 128,541,832 D184G probably damaging Het
Cacna1g C T 11: 94,409,246 A2216T probably damaging Het
Cbarp T C 10: 80,135,371 probably null Het
Cep250 C A 2: 155,994,583 L2211I possibly damaging Het
Cfap65 A G 1: 74,903,139 I1752T probably benign Het
Col4a4 A G 1: 82,453,883 V1560A unknown Het
Dapk3 A T 10: 81,184,030 Q6L probably benign Het
Dctn5 A G 7: 122,133,237 probably benign Het
Eef1akmt1 A T 14: 57,549,873 I182N possibly damaging Het
Eef1g T C 19: 8,977,591 F346S probably damaging Het
Erap1 G T 13: 74,646,279 W19L probably benign Het
Gm10801 A G 2: 98,664,064 H162R probably benign Het
Gpm6a G A 8: 55,054,810 A194T probably benign Het
Grip1 C A 10: 119,993,232 N32K probably benign Het
Hmcn1 A G 1: 150,618,936 I4134T probably damaging Het
Hspa14 G A 2: 3,498,068 H230Y probably benign Het
Ift172 T C 5: 31,256,897 T1435A probably benign Het
Igsf3 T A 3: 101,451,006 Y738N probably damaging Het
Lcor T C 19: 41,559,081 V368A possibly damaging Het
Lmna C A 3: 88,486,621 E217* probably null Het
Lrp1b C T 2: 41,341,882 G337E probably benign Het
Maf1 A G 15: 76,352,112 probably benign Het
Magi1 T C 6: 93,745,590 I436V probably damaging Het
Muc4 C T 16: 32,775,783 T3123I possibly damaging Het
Muc5b T A 7: 141,863,305 H3329Q probably benign Het
Noa1 C T 5: 77,309,746 R104Q probably benign Het
Odc1 T G 12: 17,549,472 S267A probably benign Het
Olfr484 T A 7: 108,125,162 I34F probably benign Het
Pam A G 1: 97,834,468 Y691H probably damaging Het
Pamr1 T C 2: 102,611,608 Y181H probably damaging Het
Pcdhga2 T A 18: 37,669,559 I152N probably damaging Het
Pigt C T 2: 164,506,445 Q437* probably null Het
Prx T C 7: 27,516,548 L158P probably damaging Het
Ptprh T A 7: 4,597,923 T152S probably benign Het
Pum1 G A 4: 130,730,280 R201H probably damaging Het
Rad51ap2 T C 12: 11,457,289 I404T probably benign Het
Radil C T 5: 142,543,644 R99H probably damaging Het
Rc3h2 C T 2: 37,378,887 V856I possibly damaging Het
Slx4ip T A 2: 137,046,744 V115E probably damaging Het
Snx3 C A 10: 42,526,046 S85R probably benign Het
Sppl2c A T 11: 104,187,137 E254D probably benign Het
Srms C A 2: 181,207,987 E237* probably null Het
Trank1 T C 9: 111,391,737 L2514P probably damaging Het
Trib1 C T 15: 59,651,638 R174* probably null Het
Usp4 A G 9: 108,356,504 Y108C probably damaging Het
Vmn2r60 A T 7: 42,195,423 I737F probably damaging Het
Zfp600 A T 4: 146,195,131 H123L probably benign Het
Zfp646 G T 7: 127,879,018 R122S possibly damaging Het
Znfx1 A G 2: 167,038,206 Y553H probably benign Het
Other mutations in Tenm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Tenm1 APN X 42715036 missense probably benign 0.04
R0481:Tenm1 UTSW X 42536181 missense probably damaging 1.00
R1959:Tenm1 UTSW X 42827201 missense probably benign 0.06
R1960:Tenm1 UTSW X 42827201 missense probably benign 0.06
R3734:Tenm1 UTSW X 42684067 missense probably benign 0.32
R4585:Tenm1 UTSW X 42537979 nonsense probably null
R5704:Tenm1 UTSW X 43074695 missense possibly damaging 0.58
R5706:Tenm1 UTSW X 43074695 missense possibly damaging 0.58
R6113:Tenm1 UTSW X 42827195 missense probably damaging 1.00
R8090:Tenm1 UTSW X 42555663 missense possibly damaging 0.69
X0067:Tenm1 UTSW X 42536862 missense probably damaging 1.00
Z1088:Tenm1 UTSW X 42899835 missense probably damaging 1.00
Z1176:Tenm1 UTSW X 42816803 missense probably damaging 0.96
Z1176:Tenm1 UTSW X 42816804 nonsense probably null
Z1177:Tenm1 UTSW X 42825548 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGACGTGCGAAGTGCTTG -3'
(R):5'- CCATCTATCAAGAGAATGAGTGTTCAG -3'

Sequencing Primer
(F):5'- GTGCGAAGTGCTTGATATACTACCC -3'
(R):5'- GGTTGATCAGAAAAAGCCTCTTAG -3'
Posted On2017-08-16