Incidental Mutation 'R6108:Slc6a20b'
ID485614
Institutional Source Beutler Lab
Gene Symbol Slc6a20b
Ensembl Gene ENSMUSG00000025243
Gene Namesolute carrier family 6 (neurotransmitter transporter), member 20B
SynonymsSit1, XT3, Xtrp3, Slc6a20
MMRRC Submission 044258-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6108 (G1)
Quality Score90.0077
Status Not validated
Chromosome9
Chromosomal Location123590800-123632565 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 123596186 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 539 (M539L)
Ref Sequence ENSEMBL: ENSMUSP00000026273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026270] [ENSMUST00000026273] [ENSMUST00000166800]
Predicted Effect probably benign
Transcript: ENSMUST00000026270
SMART Domains Protein: ENSMUSP00000026270
Gene: ENSMUSG00000025240

DomainStartEndE-ValueType
Pfam:Syja_N 58 346 4.7e-88 PFAM
low complexity region 400 415 N/A INTRINSIC
Blast:IPPc 416 500 3e-12 BLAST
transmembrane domain 521 543 N/A INTRINSIC
transmembrane domain 550 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026273
AA Change: M539L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000026273
Gene: ENSMUSG00000025243
AA Change: M539L

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
Pfam:SNF 48 624 5.4e-173 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166800
Predicted Effect probably benign
Transcript: ENSMUST00000168824
SMART Domains Protein: ENSMUSP00000129307
Gene: ENSMUSG00000025243

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Pfam:SNF 38 74 3.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171122
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,391,695 F5702L probably damaging Het
Aptx G A 4: 40,694,986 Q117* probably null Het
Axin1 T A 17: 26,143,240 M186K probably damaging Het
Btbd2 A T 10: 80,645,531 L249Q probably damaging Het
Caprin1 C T 2: 103,776,017 V293I possibly damaging Het
Ccdc136 C A 6: 29,412,450 H334Q probably benign Het
Ccdc180 A G 4: 45,911,389 N568S possibly damaging Het
Cenpf A T 1: 189,662,013 F515L probably benign Het
Chrm2 T A 6: 36,523,295 V29E probably damaging Het
Cnot1 A G 8: 95,730,420 L1956P probably damaging Het
Cyp2d22 T C 15: 82,371,905 K176R possibly damaging Het
Dnah7a A T 1: 53,456,845 I3151N probably damaging Het
Dsg1a T A 18: 20,340,247 D792E probably benign Het
Fam167b A T 4: 129,578,308 L23* probably null Het
Fermt3 C A 19: 7,014,414 R143L probably benign Het
Gfm2 A G 13: 97,149,422 I140V possibly damaging Het
Gna14 A G 19: 16,603,343 T182A probably damaging Het
Hmcn1 A G 1: 150,631,227 V3738A possibly damaging Het
Hspa4 C T 11: 53,261,712 G810D probably damaging Het
Igf2bp3 A G 6: 49,117,374 I154T probably damaging Het
Il1rap G A 16: 26,722,707 S566N probably damaging Het
Kcnb1 G A 2: 167,105,140 T596M probably damaging Het
Kcnn1 A C 8: 70,855,156 S81A probably benign Het
Lmod1 G A 1: 135,364,111 G235R probably benign Het
Mei1 A T 15: 82,075,188 R185S possibly damaging Het
Mmrn1 G A 6: 60,975,976 V414M possibly damaging Het
Mon2 C A 10: 123,032,695 M484I probably benign Het
Nae1 A T 8: 104,527,402 D99E probably benign Het
Nsun7 T A 5: 66,295,799 I619N probably damaging Het
Nudt12 C A 17: 59,007,749 R280L probably damaging Het
Olfr365 T C 2: 37,201,766 V175A possibly damaging Het
P2ry1 T A 3: 61,004,175 I245N probably damaging Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Plek T A 11: 16,990,058 Y217F probably damaging Het
Plpp1 A T 13: 112,866,865 I208F possibly damaging Het
Ptges3-ps C T 6: 85,844,555 noncoding transcript Het
Ptprf A G 4: 118,223,256 L1267P probably benign Het
Ptprz1 A T 6: 23,045,659 S2143C probably damaging Het
Scn9a T C 2: 66,484,049 D1764G probably damaging Het
Serpinb5 T A 1: 106,881,728 L288Q probably damaging Het
Slfnl1 A G 4: 120,533,361 T70A probably benign Het
Smtn C A 11: 3,529,608 L486F probably damaging Het
Sptbn2 G A 19: 4,731,392 probably null Het
Tas2r144 C A 6: 42,215,757 L144I possibly damaging Het
Tjp3 C T 10: 81,281,146 R183K probably benign Het
Tnip3 A G 6: 65,525,411 probably null Het
Tspan12 T A 6: 21,772,771 M212L probably benign Het
Ttn T A 2: 76,878,041 probably benign Het
Vmn1r71 T C 7: 10,748,618 M48V probably benign Het
Vmn2r10 A G 5: 108,995,801 F761S probably damaging Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Wdr72 A G 9: 74,151,668 T348A probably damaging Het
Xrn1 A T 9: 95,974,427 L333F possibly damaging Het
Other mutations in Slc6a20b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02430:Slc6a20b APN 9 123597240 missense probably damaging 1.00
IGL02741:Slc6a20b APN 9 123607602 missense probably damaging 1.00
IGL03038:Slc6a20b APN 9 123597329 missense possibly damaging 0.55
IGL03115:Slc6a20b APN 9 123597338 missense possibly damaging 0.82
IGL03228:Slc6a20b APN 9 123632132 nonsense probably null
PIT4131001:Slc6a20b UTSW 9 123612126 missense probably benign 0.00
R0653:Slc6a20b UTSW 9 123597312 missense probably damaging 1.00
R1072:Slc6a20b UTSW 9 123598459 missense probably damaging 0.97
R1759:Slc6a20b UTSW 9 123608997 critical splice donor site probably null
R1889:Slc6a20b UTSW 9 123632204 missense probably benign 0.02
R2075:Slc6a20b UTSW 9 123595034 missense probably benign 0.13
R2187:Slc6a20b UTSW 9 123598588 missense probably damaging 1.00
R4097:Slc6a20b UTSW 9 123612757 utr 3 prime probably benign
R4762:Slc6a20b UTSW 9 123598560 missense probably damaging 1.00
R4834:Slc6a20b UTSW 9 123596048 missense probably benign 0.00
R4932:Slc6a20b UTSW 9 123604796 missense probably damaging 1.00
R5079:Slc6a20b UTSW 9 123598498 missense probably damaging 1.00
R5095:Slc6a20b UTSW 9 123595054 missense probably benign
R5307:Slc6a20b UTSW 9 123603834 missense possibly damaging 0.62
R5721:Slc6a20b UTSW 9 123611989 missense probably null 1.00
R6285:Slc6a20b UTSW 9 123609096 missense possibly damaging 0.81
R6463:Slc6a20b UTSW 9 123604949 missense possibly damaging 0.62
R7050:Slc6a20b UTSW 9 123598543 missense probably damaging 1.00
R7411:Slc6a20b UTSW 9 123604948 missense probably benign 0.32
R7422:Slc6a20b UTSW 9 123607617 missense possibly damaging 0.95
R7460:Slc6a20b UTSW 9 123604949 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACACTGTTGGCTCTGCTCTG -3'
(R):5'- GTCATTCTCCCCTTAGGCAG -3'

Sequencing Primer
(F):5'- TGTTCCTCAGCCCTGCAGG -3'
(R):5'- TCCCCTTAGGCAGCATCAG -3'
Posted On2017-08-16