Incidental Mutation 'R6213:Zfp626'
ID503558
Institutional Source Beutler Lab
Gene Symbol Zfp626
Ensembl Gene ENSMUSG00000030604
Gene Namezinc finger protein 626
Synonyms
MMRRC Submission 044346-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R6213 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location27807196-27822916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27808292 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 42 (M42T)
Ref Sequence ENSEMBL: ENSMUSP00000146286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080175] [ENSMUST00000205671]
Predicted Effect probably benign
Transcript: ENSMUST00000080175
SMART Domains Protein: ENSMUSP00000079068
Gene: ENSMUSG00000030604

DomainStartEndE-ValueType
ZnF_C2H2 99 121 1.16e-1 SMART
ZnF_C2H2 127 149 8.98e0 SMART
ZnF_C2H2 155 177 5.42e-2 SMART
ZnF_C2H2 183 205 3.39e-3 SMART
ZnF_C2H2 211 233 3.69e-4 SMART
ZnF_C2H2 239 261 4.72e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205671
AA Change: M42T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A G 16: 20,400,012 Y207H probably damaging Het
Adcy7 G A 8: 88,314,137 V335M probably damaging Het
Apol11b A C 15: 77,638,000 D32E possibly damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdkn1b T A 6: 134,921,243 D108E probably benign Het
Cep290 A G 10: 100,523,360 D984G probably benign Het
Csde1 T C 3: 103,040,514 V128A probably damaging Het
Csmd3 A G 15: 47,629,260 S3162P probably damaging Het
D5Ertd579e G A 5: 36,602,634 T1394I probably damaging Het
Ddx6 T A 9: 44,628,693 L306Q probably damaging Het
Dmxl1 T A 18: 49,863,015 S403T possibly damaging Het
F11 G T 8: 45,241,500 T608K probably damaging Het
Flrt3 C T 2: 140,661,165 R181H probably damaging Het
Hs3st1 A T 5: 39,614,521 C260S probably damaging Het
Ighv7-1 A T 12: 113,896,521 S84T probably damaging Het
Inpp4b A G 8: 81,997,390 D332G probably damaging Het
Irf2bpl T C 12: 86,883,593 Q102R probably benign Het
Itpr3 T A 17: 27,111,200 D1597E probably benign Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Lypd8 A G 11: 58,390,334 T241A probably benign Het
Map1lc3a T C 2: 155,277,015 probably null Het
Mast1 G A 8: 84,915,569 T1052I probably damaging Het
Muc2 T C 7: 141,751,414 C152R probably damaging Het
Muc5b A T 7: 141,862,166 M2950L probably benign Het
Muc5b A G 7: 141,867,619 D4282G possibly damaging Het
Myo16 G T 8: 10,370,963 probably null Het
Myo9a T A 9: 59,827,258 F708I probably damaging Het
Nadsyn1 A T 7: 143,799,812 F558Y probably benign Het
Nat9 A T 11: 115,185,106 W30R probably damaging Het
Nipbl A G 15: 8,334,906 L1338S probably damaging Het
Nipsnap3b A G 4: 53,017,066 T97A probably benign Het
Npepps A T 11: 97,241,997 Y301* probably null Het
Nrcam C T 12: 44,562,432 P447S possibly damaging Het
Olfr237-ps1 A G 6: 43,153,887 N194S possibly damaging Het
Olfr295 A G 7: 86,585,277 M1V probably null Het
Olfr547 T C 7: 102,534,932 Y62H probably damaging Het
Olfr99 T C 17: 37,280,373 S16G probably benign Het
Pacsin3 G T 2: 91,260,434 V29F probably damaging Het
Pdzrn3 A C 6: 101,377,844 D15E probably damaging Het
Phf20l1 T C 15: 66,632,903 probably null Het
Pign A C 1: 105,589,266 V545G possibly damaging Het
Pkhd1 T C 1: 20,523,770 N1373S possibly damaging Het
Ptchd4 T A 17: 42,377,360 H264Q probably benign Het
Ptpn3 G T 4: 57,265,012 Q73K probably damaging Het
Ptrh1 G A 2: 32,776,745 V109I probably benign Het
Reg1 A T 6: 78,427,403 I87F possibly damaging Het
Rrp12 C A 19: 41,868,778 V1186L probably benign Het
Sall1 AGTGGTGGTGGTGGTGGTGGTGG AGTGGTGGTGGTGGTGGTGG 8: 89,033,058 probably benign Het
Slc23a3 A C 1: 75,131,748 F279V probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Suds3 A G 5: 117,106,662 L115P probably damaging Het
Tekt2 G A 4: 126,323,196 A260V probably damaging Het
Tgfb3 T A 12: 86,057,847 Y391F probably damaging Het
Topbp1 T C 9: 103,332,751 S866P probably benign Het
Tspan14 A G 14: 40,913,415 Y175H probably benign Het
Vars2 T C 17: 35,660,440 T568A probably benign Het
Vmn1r216 T G 13: 23,099,169 D7E probably benign Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zfp281 T C 1: 136,625,512 V76A probably benign Het
Zfp36l2 T C 17: 84,186,552 N219S probably damaging Het
Zscan21 C T 5: 138,125,097 P13S probably benign Het
Other mutations in Zfp626
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0726:Zfp626 UTSW 7 27818623 missense probably damaging 1.00
R0973:Zfp626 UTSW 7 27818482 missense probably damaging 0.97
R0973:Zfp626 UTSW 7 27818482 missense probably damaging 0.97
R0974:Zfp626 UTSW 7 27818482 missense probably damaging 0.97
R3085:Zfp626 UTSW 7 27818162 missense probably benign 0.12
R5421:Zfp626 UTSW 7 27817910 missense probably damaging 0.97
R6950:Zfp626 UTSW 7 27818914 missense probably damaging 1.00
R7190:Zfp626 UTSW 7 27818343 missense probably benign
R7359:Zfp626 UTSW 7 27808235 missense probably damaging 1.00
R7547:Zfp626 UTSW 7 27818403 missense possibly damaging 0.86
R7783:Zfp626 UTSW 7 27818370 missense possibly damaging 0.83
R7889:Zfp626 UTSW 7 27819499 missense probably benign 0.03
R7982:Zfp626 UTSW 7 27810750 critical splice acceptor site probably null
R8011:Zfp626 UTSW 7 27818715 missense possibly damaging 0.85
R8318:Zfp626 UTSW 7 27818245 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAGGTGCCTTGAACATTTCC -3'
(R):5'- AGAAGAAGGAACTCGGCTCC -3'

Sequencing Primer
(F):5'- CAGGTGCCTTGAACATTTCCTTATGG -3'
(R):5'- CCTGTAGACTAGGTTAGCCTGGAAC -3'
Posted On2018-02-27