Incidental Mutation 'R6271:Olfr358'
ID507313
Institutional Source Beutler Lab
Gene Symbol Olfr358
Ensembl Gene ENSMUSG00000075379
Gene Nameolfactory receptor 358
SynonymsMOR159-4, GA_x6K02T2NLDC-33697309-33696317
MMRRC Submission 044379-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6271 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location37002163-37009335 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37005542 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 24 (Q24R)
Ref Sequence ENSEMBL: ENSMUSP00000150781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100146] [ENSMUST00000213218] [ENSMUST00000216437]
Predicted Effect probably damaging
Transcript: ENSMUST00000100146
AA Change: Q24R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097724
Gene: ENSMUSG00000075379
AA Change: Q24R

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.4e-49 PFAM
Pfam:7TM_GPCR_Srsx 35 214 4.7e-7 PFAM
Pfam:7tm_1 41 289 2.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213218
Predicted Effect probably damaging
Transcript: ENSMUST00000216437
AA Change: Q24R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 G T 4: 133,064,724 C1092F possibly damaging Het
Aplf T C 6: 87,646,248 E304G possibly damaging Het
Atp12a A G 14: 56,378,422 D547G probably benign Het
B3gat2 T C 1: 23,815,261 L212P probably damaging Het
Babam2 G T 5: 32,001,362 A219S probably damaging Het
Ccdc18 A C 5: 108,174,887 S618R possibly damaging Het
Ces2c G A 8: 104,852,116 G342D probably damaging Het
Cfap57 A C 4: 118,595,759 D582E probably benign Het
Cisd2 T C 3: 135,408,866 N115D possibly damaging Het
Cyp17a1 A G 19: 46,672,720 F42L probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fam234a T C 17: 26,218,237 D156G probably benign Het
Fer1l6 T A 15: 58,641,918 I1554K probably benign Het
Fv1 A G 4: 147,870,017 T347A possibly damaging Het
Gm5134 T A 10: 75,995,809 C361S probably benign Het
Gm5415 T A 1: 32,545,491 D446V probably damaging Het
Grin3a T C 4: 49,792,516 I406V probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ifna13 A C 4: 88,643,845 L181V possibly damaging Het
Irx4 A G 13: 73,266,594 probably null Het
Kcna3 T A 3: 107,037,606 M395K probably damaging Het
Kcnma1 A T 14: 23,509,889 V347D probably damaging Het
Kng2 A T 16: 23,003,948 V218E probably benign Het
Krt36 G A 11: 100,104,472 Q167* probably null Het
Lama2 T C 10: 27,023,329 D2457G possibly damaging Het
Ldah G A 12: 8,268,599 probably null Het
Lhfpl3 G T 5: 22,746,244 A18S probably benign Het
Lrrk1 A G 7: 66,307,103 probably null Het
Ltv1 T C 10: 13,179,701 Y352C probably damaging Het
Lyst G T 13: 13,658,754 M1720I probably benign Het
Mkx A T 18: 6,937,059 probably null Het
Myo18a A G 11: 77,820,809 H626R probably damaging Het
Nop9 A C 14: 55,753,741 Q618H probably damaging Het
Olfr1255 T C 2: 89,816,562 S73P probably damaging Het
Olfr25 T C 9: 38,330,282 S232P probably benign Het
Olfr850 A G 9: 19,478,041 S67P probably damaging Het
Otog C A 7: 46,252,040 Q388K probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Oxct2b T G 4: 123,117,715 V476G probably damaging Het
Parp10 T C 15: 76,242,002 T329A probably benign Het
Pcdhga5 T C 18: 37,696,682 S728P probably benign Het
Piezo1 G T 8: 122,494,932 H574Q probably damaging Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Pqlc3 T C 12: 16,997,703 D76G probably damaging Het
Preb C A 5: 30,958,051 V255F probably damaging Het
Prmt9 A G 8: 77,577,463 N725S probably damaging Het
Ric1 A T 19: 29,567,365 probably null Het
Serinc3 G C 2: 163,630,976 L245V probably benign Het
Sgce T C 6: 4,730,015 K70E possibly damaging Het
Simc1 T G 13: 54,539,724 V102G probably damaging Het
Smyd2 A G 1: 189,883,852 Y362H probably damaging Het
Sptbn1 G T 11: 30,100,660 H2310N probably benign Het
Syne1 T C 10: 5,234,652 Y4077C probably damaging Het
Syne2 C A 12: 75,890,381 A251E probably damaging Het
Taok1 A T 11: 77,573,783 L159Q probably damaging Het
Timeless T C 10: 128,250,724 L1043P probably damaging Het
Tmprss3 T C 17: 31,186,562 E352G probably damaging Het
Trav6-4 A T 14: 53,454,582 T46S probably benign Het
Ubiad1 A T 4: 148,436,626 Y180* probably null Het
Usp47 A G 7: 112,087,056 E627G probably damaging Het
Vmn2r124 A G 17: 18,062,883 T280A probably benign Het
Other mutations in Olfr358
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Olfr358 APN 2 37004930 missense probably benign 0.00
IGL01460:Olfr358 APN 2 37004636 missense probably benign 0.06
IGL02066:Olfr358 APN 2 37005309 missense probably damaging 1.00
R0081:Olfr358 UTSW 2 37005450 missense probably damaging 1.00
R0129:Olfr358 UTSW 2 37005045 nonsense probably null
R1441:Olfr358 UTSW 2 37005119 missense possibly damaging 0.82
R1543:Olfr358 UTSW 2 37005127 missense probably damaging 1.00
R1628:Olfr358 UTSW 2 37004726 missense probably damaging 1.00
R1966:Olfr358 UTSW 2 37004948 missense possibly damaging 0.49
R2338:Olfr358 UTSW 2 37005147 missense probably damaging 1.00
R4826:Olfr358 UTSW 2 37005333 missense probably damaging 0.99
R7359:Olfr358 UTSW 2 37005437 missense probably damaging 1.00
R7487:Olfr358 UTSW 2 37004774 missense probably damaging 0.98
X0028:Olfr358 UTSW 2 37005599 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTACCAGCATCTGAGGAAC -3'
(R):5'- CAATCACTTCTACCATCATCTTGGG -3'

Sequencing Primer
(F):5'- TACCAGCATCTGAGGAACAGTGATG -3'
(R):5'- CCATCATCTTGGGTAAGTTCAATTG -3'
Posted On2018-03-15