Incidental Mutation 'R6271:Olfr850'
ID507337
Institutional Source Beutler Lab
Gene Symbol Olfr850
Ensembl Gene ENSMUSG00000094535
Gene Nameolfactory receptor 850
SynonymsGA_x6K02T2PVTD-13214162-13213224, MOR147-2
MMRRC Submission 044379-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R6271 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location19477301-19478248 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19478041 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 67 (S67P)
Ref Sequence ENSEMBL: ENSMUSP00000148623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077347] [ENSMUST00000211832]
Predicted Effect probably damaging
Transcript: ENSMUST00000077347
AA Change: S70P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076569
Gene: ENSMUSG00000094535
AA Change: S70P

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:7tm_4 34 311 1.8e-51 PFAM
Pfam:7TM_GPCR_Srsx 38 304 1e-6 PFAM
Pfam:7tm_1 44 293 5.1e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211832
AA Change: S67P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 G T 4: 133,064,724 C1092F possibly damaging Het
Aplf T C 6: 87,646,248 E304G possibly damaging Het
Atp12a A G 14: 56,378,422 D547G probably benign Het
B3gat2 T C 1: 23,815,261 L212P probably damaging Het
Babam2 G T 5: 32,001,362 A219S probably damaging Het
Ccdc18 A C 5: 108,174,887 S618R possibly damaging Het
Ces2c G A 8: 104,852,116 G342D probably damaging Het
Cfap57 A C 4: 118,595,759 D582E probably benign Het
Cisd2 T C 3: 135,408,866 N115D possibly damaging Het
Cyp17a1 A G 19: 46,672,720 F42L probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fam234a T C 17: 26,218,237 D156G probably benign Het
Fer1l6 T A 15: 58,641,918 I1554K probably benign Het
Fv1 A G 4: 147,870,017 T347A possibly damaging Het
Gm5134 T A 10: 75,995,809 C361S probably benign Het
Gm5415 T A 1: 32,545,491 D446V probably damaging Het
Grin3a T C 4: 49,792,516 I406V probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ifna13 A C 4: 88,643,845 L181V possibly damaging Het
Irx4 A G 13: 73,266,594 probably null Het
Kcna3 T A 3: 107,037,606 M395K probably damaging Het
Kcnma1 A T 14: 23,509,889 V347D probably damaging Het
Kng2 A T 16: 23,003,948 V218E probably benign Het
Krt36 G A 11: 100,104,472 Q167* probably null Het
Lama2 T C 10: 27,023,329 D2457G possibly damaging Het
Ldah G A 12: 8,268,599 probably null Het
Lhfpl3 G T 5: 22,746,244 A18S probably benign Het
Lrrk1 A G 7: 66,307,103 probably null Het
Ltv1 T C 10: 13,179,701 Y352C probably damaging Het
Lyst G T 13: 13,658,754 M1720I probably benign Het
Mkx A T 18: 6,937,059 probably null Het
Myo18a A G 11: 77,820,809 H626R probably damaging Het
Nop9 A C 14: 55,753,741 Q618H probably damaging Het
Olfr1255 T C 2: 89,816,562 S73P probably damaging Het
Olfr25 T C 9: 38,330,282 S232P probably benign Het
Olfr358 T C 2: 37,005,542 Q24R probably damaging Het
Otog C A 7: 46,252,040 Q388K probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Oxct2b T G 4: 123,117,715 V476G probably damaging Het
Parp10 T C 15: 76,242,002 T329A probably benign Het
Pcdhga5 T C 18: 37,696,682 S728P probably benign Het
Piezo1 G T 8: 122,494,932 H574Q probably damaging Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Pqlc3 T C 12: 16,997,703 D76G probably damaging Het
Preb C A 5: 30,958,051 V255F probably damaging Het
Prmt9 A G 8: 77,577,463 N725S probably damaging Het
Ric1 A T 19: 29,567,365 probably null Het
Serinc3 G C 2: 163,630,976 L245V probably benign Het
Sgce T C 6: 4,730,015 K70E possibly damaging Het
Simc1 T G 13: 54,539,724 V102G probably damaging Het
Smyd2 A G 1: 189,883,852 Y362H probably damaging Het
Sptbn1 G T 11: 30,100,660 H2310N probably benign Het
Syne1 T C 10: 5,234,652 Y4077C probably damaging Het
Syne2 C A 12: 75,890,381 A251E probably damaging Het
Taok1 A T 11: 77,573,783 L159Q probably damaging Het
Timeless T C 10: 128,250,724 L1043P probably damaging Het
Tmprss3 T C 17: 31,186,562 E352G probably damaging Het
Trav6-4 A T 14: 53,454,582 T46S probably benign Het
Ubiad1 A T 4: 148,436,626 Y180* probably null Het
Usp47 A G 7: 112,087,056 E627G probably damaging Het
Vmn2r124 A G 17: 18,062,883 T280A probably benign Het
Other mutations in Olfr850
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02723:Olfr850 APN 9 19477509 missense probably damaging 1.00
IGL03294:Olfr850 APN 9 19477989 missense possibly damaging 0.95
PIT4305001:Olfr850 UTSW 9 19478061 missense probably damaging 1.00
R0364:Olfr850 UTSW 9 19477972 nonsense probably null
R0379:Olfr850 UTSW 9 19477480 missense possibly damaging 0.75
R0449:Olfr850 UTSW 9 19478092 missense possibly damaging 0.89
R0682:Olfr850 UTSW 9 19477349 missense probably benign 0.03
R0693:Olfr850 UTSW 9 19477972 nonsense probably null
R1484:Olfr850 UTSW 9 19478127 missense probably damaging 1.00
R1599:Olfr850 UTSW 9 19478221 missense probably damaging 0.97
R1626:Olfr850 UTSW 9 19478199 missense probably damaging 1.00
R1742:Olfr850 UTSW 9 19478041 missense probably damaging 1.00
R4232:Olfr850 UTSW 9 19477726 missense probably damaging 0.98
R4237:Olfr850 UTSW 9 19477597 missense probably benign 0.00
R5116:Olfr850 UTSW 9 19477798 missense possibly damaging 0.67
R5643:Olfr850 UTSW 9 19477557 missense probably benign 0.22
R6815:Olfr850 UTSW 9 19477765 missense probably benign 0.20
R7222:Olfr850 UTSW 9 19477467 missense probably damaging 1.00
R7592:Olfr850 UTSW 9 19477832 missense possibly damaging 0.52
X0058:Olfr850 UTSW 9 19478223 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ACGGTCATAAGCCATTACTGC -3'
(R):5'- GGTGTGGCAGCTTTATCCAAAG -3'

Sequencing Primer
(F):5'- CTGCAAGGAGACAGTTTTCCATGC -3'
(R):5'- CTCTGTCAGATTTATGAACAACATGG -3'
Posted On2018-03-15